Loading
PDBj
✖
MenuPDBj@FacebookPDBj@X(formerly Twitter)PDBj@BlueSkyPDBj@YouTubewwPDB FoundationwwPDBDonate
RCSB PDBPDBeBMRBAdv. SearchSearch help

5BTF

Crystal structure of a topoisomerase II complex

Entity
Entity IDChain IDDescriptionTypeChain lengthFormula weightNumber of moleculesDB Name (Accession)Biological sourceDescriptive keywords
1A, C
(A, C)
DNA gyrase subunit Apolymer50356225.42UniProt (P9WG47)
Pfam (PF00521)
Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
2B, D
(B, D)
DNA gyrase subunit Bpolymer25328272.42UniProt (P9WG45)
Pfam (PF01751)
Pfam (PF00986)
Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
3E, H
(E, H)
DNA substrate 24-mer GGTCATGAATGACTATGCACGTAApolymer247417.82synthetic construct
4F, G
(F, G)
DNA substrate 24-mer TTACGTGCATAGTCATTCATGACCpolymer247319.72synthetic construct
5I, J, K, L
(B, C, D, E)
MAGNESIUM IONnon-polymer24.34Chemie (MG)
PubChem (888)
6M, N
(F, G)
1-cyclopropyl-6-fluoro-8-methoxy-7-[(3S)-3-methylpiperazin-1-yl]-4-oxo-1,4-dihydroquinoline-3-carboxylic acidnon-polymer375.42Chemie (GFN)
PubChem (1150508)
7O, P, Q, R, S...
(A, B, C, D, E...)
waterwater18.0191Chemie (HOH)
Sequence modifications
A, C: 2 - 500 (UniProt: P9WG47)
PDBExternal DatabaseDetails
Ser 90Ala 90engineered mutation
Ile 501-expression tag
Gly 502-expression tag
Ser 503-expression tag
Gly 504-expression tag
B, D: 426 - 675 (UniProt: P9WG45)
PDBExternal DatabaseDetails
Ser 423-expression tag
Asn 424-expression tag
Ala 425-expression tag
Sequence viewer
Contents of the asymmetric unit
PolymersNumber of chains8
Total formula weight198470.8
Non-Polymers*Number of molecules6
Total formula weight848.0
All*Total formula weight199318.8
*Water molecules are not included.

260320

PDB entries from 2026-09-30

PDB statisticsPDBj update infoContact PDBjnumon