4P0S
human Mus81-Eme1-3'flap DNA complex
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | A, C, E, G (A, C, E, G) | Crossover junction endonuclease MUS81 | polymer | 306 | 34015.8 | 4 | UniProt (Q96NY9) Pfam (PF02732) Pfam (PF21292) | Homo sapiens (Human) | |
| 2 | B, D, F, H (B, D, F, H) | Crossover junction endonuclease EME1 | polymer | 393 | 43740.9 | 4 | UniProt (Q96AY2) Pfam (PF02732) Pfam (PF21292) | Homo sapiens (Human) | MMS4 homolog,hMMS4 |
| 3 | I, L, O, R (I, M, Q, U) | DNA GAATGTGTGTCT | polymer | 12 | 3708.4 | 4 | synthetic construct | ||
| 4 | J, M, P, S (J, N, R, V) | DNA TAGACACACATTCGGGACATGCAG | polymer | 24 | 7387.8 | 4 | synthetic construct | ||
| 5 | K, N, Q, T (L, P, T, X) | DNA TCTGCATGTCATT | polymer | 13 | 3932.6 | 4 | synthetic construct |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 20 |
| Total formula weight | 371141.8 | |
| All* | Total formula weight | 371141.8 |
