Loading
PDBj
MenuPDBj@FacebookPDBj@X(formerly Twitter)PDBj@BlueSkyPDBj@YouTubewwPDB FoundationwwPDBDonate
RCSB PDBPDBeBMRBAdv. SearchSearch help

1KX4

X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution

Entity
Entity IDChain IDDescriptionTypeChain lengthFormula weightNumber of moleculesDB Name (Accession)Biological sourceDescriptive keywords
1A, B
(I, J)
DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3')polymer14645054.82Homo sapiens (human)
2C, G
(A, E)
histone H3polymer13515303.92UniProt (P16105)
Pfam (PF00125)
UniProt (by SIFTS) (P84233)
Xenopus laevis (African clawed frog)
3D, H
(B, F)
histone H4polymer10211263.22UniProt (P02304)
Pfam (PF15511)
UniProt (by SIFTS) (P62799)
Xenopus laevis (African clawed frog)
4E, I
(C, G)
histone H2A.1polymer12813907.22UniProt (P06897)
Pfam (PF00125)
Pfam (PF16211)
Xenopus laevis (African clawed frog)
5F, J
(D, H)
histone H2B.2polymer12513848.12UniProt (P02281)
Pfam (PF00125)
Xenopus laevis (African clawed frog)
6K, L, M, N, O...
(I, J, A)
MANGANESE (II) IONnon-polymer54.96Chemie (MN)
7Q, R, S, T
(A, C, E, G)
CHLORIDE IONnon-polymer35.54Chemie (CL)
8AA, BA, CA, DA, U...
(E, F, G, H, I...)
waterwater18.0433Chemie (HOH)
Sequence modifications
A, E: 1 - 135 (UniProt: P16105)
PDBExternal DatabaseDetails
Ala 102Gly 102conflict
C, G: 1 - 128 (UniProt: P06897)
PDBExternal DatabaseDetails
Arg 99Gly 99variant
Ser 123Ala 123conflict
-Ala 126deletion
D, H: -2 - 122 (UniProt: P02281)
PDBExternal DatabaseDetails
Thr 29Ser 32variant
Sequence viewer
Contents of the asymmetric unit
PolymersNumber of chains10
Total formula weight198754.5
Non-Polymers*Number of molecules10
Total formula weight471.4
All*Total formula weight199226.0
*Water molecules are not included.

250835

PDB entries from 2026-03-18

PDB statisticsPDBj update infoContact PDBjnumon