5E3M
Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)
History
Please read more about PDB versioning on our help page.
| Version | Date | Type | |
| 1-0 | 2016-03-09 | Initial release | No files available. |
| 1-1 | 2016-03-23 | Database references | No files available. |
| 1-2 | 2022-03-23 | Author supporting evidence, Data collection, Database references, Derived calculations | No files available. |
| 1-3 | 2024-05-22 | Data collection |






