1FE8
 
 | | CRYSTAL STRUCTURE OF THE VON WILLEBRAND FACTOR A3 DOMAIN IN COMPLEX WITH A FAB FRAGMENT OF IGG RU5 THAT INHIBITS COLLAGEN BINDING | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, CACODYLATE ION, IMMUNOGLOBULIN IGG RU5, ... | | Authors: | Bouma, B, Huizinga, E.G, Schiphorst, M.E, Sixma, J.J, Kroon, J, Gros, P. | | Deposit date: | 2000-07-21 | | Release date: | 2001-04-04 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (2.03 Å) | | Cite: | Identification of the collagen-binding site of the von Willebrand factor A3-domain.
J.Biol.Chem., 276, 2001
|
|
1FEA
 | |
1FEB
 | |
1FEC
 | |
1FEU
 | | CRYSTAL STRUCTURE OF RIBOSOMAL PROTEIN TL5, ONE OF THE CTC FAMILY PROTEINS, COMPLEXED WITH A FRAGMENT OF 5S RRNA. | | Descriptor: | 19 NT FRAGMENT OF 5S RRNA, 21 NT FRAGMENT OF 5S RRNA, 50S RIBOSOMAL PROTEIN L25, ... | | Authors: | Fedorov, R.V, Meshcheryakov, V.A, Gongadze, G.M, Fomenkova, N.P, Nevskaya, N.A, Selmer, M, Laurberg, M, Kristensen, O, Al-Karadaghi, S, Liljas, A, Garber, M.B, Nikonov, S.V. | | Deposit date: | 2000-07-23 | | Release date: | 2001-06-25 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Structure of ribosomal protein TL5 complexed with RNA provides new insights into the CTC family of stress proteins.
Acta Crystallogr.,Sect.D, 57, 2001
|
|
1FEV
 | |
1FEZ
 | | THE CRYSTAL STRUCTURE OF BACILLUS CEREUS PHOSPHONOACETALDEHYDE HYDROLASE COMPLEXED WITH TUNGSTATE, A PRODUCT ANALOG | | Descriptor: | MAGNESIUM ION, PHOSPHONOACETALDEHYDE HYDROLASE, TUNGSTATE(VI)ION | | Authors: | Morais, M.C, Zhang, W, Baker, A.S, Zhang, G, Dunaway-Mariano, D, Allen, K.N. | | Deposit date: | 2000-07-24 | | Release date: | 2000-10-04 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The crystal structure of bacillus cereus phosphonoacetaldehyde hydrolase: insight into catalysis of phosphorus bond cleavage and catalytic diversification within the HAD enzyme superfamily.
Biochemistry, 39, 2000
|
|
1FF9
 | | APO SACCHAROPINE REDUCTASE | | Descriptor: | SACCHAROPINE REDUCTASE, SULFATE ION | | Authors: | Johansson, E, Steffens, J.J, Lindqvist, Y, Schneider, G. | | Deposit date: | 2000-07-25 | | Release date: | 2000-11-08 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Crystal structure of saccharopine reductase from Magnaporthe grisea, an enzyme of the alpha-aminoadipate pathway of lysine biosynthesis.
Structure Fold.Des., 8, 2000
|
|
1FFG
 | | CHEY-BINDING DOMAIN OF CHEA IN COMPLEX WITH CHEY AT 2.1 A RESOLUTION | | Descriptor: | CHEMOTAXIS PROTEIN CHEA, CHEMOTAXIS PROTEIN CHEY, MANGANESE (II) ION | | Authors: | Gouet, P, Chinardet, N, Welch, M, Guillet, V, Birck, C, Mourey, L, Samama, J.-P. | | Deposit date: | 2000-07-25 | | Release date: | 2001-01-17 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Further insights into the mechanism of function of the response regulator CheY from crystallographic studies of the CheY--CheA(124--257) complex.
Acta Crystallogr.,Sect.D, 57, 2001
|
|
1FFH
 | | N AND GTPASE DOMAINS OF THE SIGNAL SEQUENCE RECOGNITION PROTEIN FFH FROM THERMUS AQUATICUS | | Descriptor: | FFH, MAGNESIUM ION | | Authors: | Freymann, D.M, Keenan, R.J, Stroud, R.M, Walter, P. | | Deposit date: | 1996-12-30 | | Release date: | 1997-12-31 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | Structure of the conserved GTPase domain of the signal recognition particle.
Nature, 385, 1997
|
|
1FFK
 | | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-25 | | Release date: | 2000-08-14 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
|
|
1FFN
 | | CRYSTAL STRUCTURE OF MURINE CLASS I H-2DB COMPLEXED WITH PEPTIDE GP33(C9M) | | Descriptor: | BETA-2 MICROGLOBULIN, BETA CHAIN, H-2 CLASS I HISTOCOMPATIBILITY ANTIGEN, ... | | Authors: | Wang, B, Sharma, A, Maile, R, Saad, M, Collins, E.J, Frelinger, J.A. | | Deposit date: | 2000-07-25 | | Release date: | 2002-12-11 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Peptidic termini play a significant role in TCR recognition
J.IMMUNOL., 169, 2002
|
|
1FFO
 | | CRYSTAL STRUCTURE OF MURINE CLASS I H-2DB COMPLEXED WITH SYNTHETIC PEPTIDE GP33 (C9M/K1A) | | Descriptor: | BETA-2 MICROGLOBULIN BETA CHAIN, H-2 CLASS I HISTOCOMPATIBILITY ANTIGEN, D-B, ... | | Authors: | Wang, B, Sharma, A, Maile, R, Saad, M, Collins, E.J, Frelinger, J.A. | | Deposit date: | 2000-07-25 | | Release date: | 2002-12-11 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Peptidic termini play a significant role in TCR recognition.
J.Immunol., 169, 2002
|
|
1FFP
 | | CRYSTAL STRUCTURE OF MURINE CLASS I H-2DB COMPLEXED WITH PEPTIDE GP33 (C9M/K1S) | | Descriptor: | BETA-2 MICROGLOBULIN BETA CHAIN, H-2 CLASS I HISTOCOMPATIBILITY ANTIGEN, D-B, ... | | Authors: | Wang, B, Sharma, A, Maile, R, Saad, M, Collins, E.J, Frelinger, J.A. | | Deposit date: | 2000-07-25 | | Release date: | 2002-12-11 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Peptidic termini play a significant role in TCR recognition
J.IMMUNOL., 169, 2002
|
|
1FFQ
 | | CRYSTAL STRUCTURE OF CHITINASE A COMPLEXED WITH ALLOSAMIDIN | | Descriptor: | 2-acetamido-2-deoxy-beta-D-allopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-allopyranose, ALLOSAMIZOLINE, CHITINASE A | | Authors: | Papanikolau, Y, Tavlas, G, Vorgias, C.E, Petratos, K. | | Deposit date: | 2000-07-26 | | Release date: | 2003-02-11 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | De novo purification scheme and crystallization conditions yield high-resolution structures of chitinase A and its complex with the inhibitor allosamidin.
Acta Crystallogr.,Sect.D, 59, 2003
|
|
1FFR
 | | CRYSTAL STRUCTURE OF CHITINASE A MUTANT Y390F COMPLEXED WITH HEXA-N-ACETYLCHITOHEXAOSE (NAG)6 | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, CHITINASE A | | Authors: | Papanikolau, Y, Prag, G, Tavlas, G, Vorgias, C.E, Oppenheim, A.B, Petratos, K. | | Deposit date: | 2000-07-26 | | Release date: | 2001-09-26 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | High resolution structural analyses of mutant chitinase A complexes with substrates provide new insight into the mechanism of catalysis.
Biochemistry, 40, 2001
|
|
1FFS
 | | CHEY-BINDING DOMAIN OF CHEA IN COMPLEX WITH CHEY FROM CRYSTALS SOAKED IN ACETYL PHOSPHATE | | Descriptor: | CHEMOTAXIS PROTEIN CHEA, CHEMOTAXIS PROTEIN CHEY, MANGANESE (II) ION | | Authors: | Gouet, P, Chinardet, N, Welch, M, Guillet, V, Birck, C, Mourey, L, Samama, J.-P. | | Deposit date: | 2000-07-26 | | Release date: | 2001-01-17 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Further insights into the mechanism of function of the response regulator CheY from crystallographic studies of the CheY--CheA(124--257) complex.
Acta Crystallogr.,Sect.D, 57, 2001
|
|
1FFW
 | | CHEY-BINDING DOMAIN OF CHEA IN COMPLEX WITH CHEY WITH A BOUND IMIDO DIPHOSPHATE | | Descriptor: | CHEMOTAXIS PROTEIN CHEA, CHEMOTAXIS PROTEIN CHEY, IMIDO DIPHOSPHATE, ... | | Authors: | Gouet, P, Chinardet, N, Welch, M, Guillet, V, Birck, C, Mourey, L, Samama, J.-P. | | Deposit date: | 2000-07-26 | | Release date: | 2001-01-17 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Further insights into the mechanism of function of the response regulator CheY from crystallographic studies of the CheY--CheA(124--257) complex.
Acta Crystallogr.,Sect.D, 57, 2001
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FG2
 | | CRYSTAL STRUCTURE OF THE LCMV PEPTIDIC EPITOPE GP33 IN COMPLEX WITH THE MURINE CLASS I MHC MOLECULE H-2DB | | Descriptor: | BETA-2 MICROGLOBULIN, H-2 CLASS I HISTOCOMPATIBILITY ANTIGEN, D-B ALPHA CHAIN, ... | | Authors: | Tissot, A.C, Ciatto, C, Mittl, P.R.E, Gruetter, M.G, Plueckthun, A. | | Deposit date: | 2000-07-27 | | Release date: | 2000-10-04 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.754 Å) | | Cite: | Viral escape at the molecular level explained by quantitative T-cell receptor/peptide/MHC interactions and the crystal structure of a peptide/MHC complex.
J.Mol.Biol., 302, 2000
|
|
1FG3
 | | CRYSTAL STRUCTURE OF L-HISTIDINOL PHOSPHATE AMINOTRANSFERASE COMPLEXED WITH L-HISTIDINOL | | Descriptor: | HISTIDINOL PHOSPHATE AMINOTRANSFERASE, PHOSPHORIC ACID MONO-[2-AMINO-3-(3H-IMIDAZOL-4-YL)-PROPYL]ESTER, PYRIDOXAL-5'-PHOSPHATE | | Authors: | Sivaraman, J, Cygler, M. | | Deposit date: | 2000-07-27 | | Release date: | 2001-08-22 | | Last modified: | 2017-10-04 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Crystal structure of histidinol phosphate aminotransferase (HisC) from Escherichia coli, and its covalent complex with pyridoxal-5'-phosphate and l-histidinol phosphate.
J.Mol.Biol., 311, 2001
|
|
1FG4
 | | STRUCTURE OF TRYPAREDOXIN II | | Descriptor: | TRYPAREDOXIN II | | Authors: | Hofmann, B, Budde, H, Bruns, K, Guerrero, S.A, Kalisz, H.M, Menge, U, Montemartini, M, Nogoceke, E, Steinert, P, Wissing, J.B, Flohe, L, Hecht, H.J. | | Deposit date: | 2000-07-28 | | Release date: | 2001-04-25 | | Last modified: | 2017-10-04 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Structures of tryparedoxins revealing interaction with trypanothione.
Biol.Chem., 382, 2001
|
|
1FG5
 | | CRYSTAL STRUCTURE OF BOVINE ALPHA-1,3-GALACTOSYLTRANSFERASE CATALYTIC DOMAIN. | | Descriptor: | N-ACETYLLACTOSAMINIDE ALPHA-1,3-GALACTOSYLTRANSFERASE | | Authors: | Gastinel, L.N, Bignon, C, Shaper, J.H, Joziasse, D.H. | | Deposit date: | 2000-07-28 | | Release date: | 2001-07-28 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Bovine alpha1,3-galactosyltransferase catalytic domain structure and its relationship with ABO histo-blood group and glycosphingolipid glycosyltransferases.
EMBO J., 20, 2001
|
|
1FG7
 | |
