[English] 日本語
Yorodumi
- PDB-5j05: DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG)... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 5j05
TitleDIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium
ComponentsDNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3')
KeywordsDNA / Quadruplex (-ld+l) topology / Structure from MOLMOL
Function / homologyDNA / DNA (> 10)
Function and homology information
Biological speciessynthetic construct (others)
MethodSOLUTION NMR / molecular dynamics
AuthorsDvorkin, S.A. / Karsisiotis, A.I. / Webba da Silva, M.
CitationJournal: Sci Adv / Year: 2018
Title: Encoding canonical DNA quadruplex structure.
Authors: Dvorkin, S.A. / Karsisiotis, A.I. / Webba da Silva, M.
History
DepositionMar 27, 2016Deposition site: RCSB / Processing site: PDBE
Revision 1.0Apr 5, 2017Provider: repository / Type: Initial release
Revision 1.1Oct 10, 2018Group: Data collection / Database references / Category: citation / citation_author
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.journal_volume / _citation.page_first / _citation.page_last / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year / _citation_author.identifier_ORCID
Revision 1.2May 8, 2019Group: Data collection / Category: pdbx_nmr_software / pdbx_seq_map_depositor_info
Item: _pdbx_nmr_software.name / _pdbx_seq_map_depositor_info.one_letter_code_mod
Revision 1.3Oct 23, 2019Group: Data collection / Derived calculations / Experimental preparation
Category: ndb_struct_na_base_pair / ndb_struct_na_base_pair_step ...ndb_struct_na_base_pair / ndb_struct_na_base_pair_step / pdbx_nmr_exptl_sample_conditions / struct_conn
Item: _pdbx_nmr_exptl_sample_conditions.temperature / _pdbx_nmr_exptl_sample_conditions.temperature_units
Revision 1.4May 15, 2024Group: Data collection / Database references / Category: chem_comp_atom / chem_comp_bond / database_2
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3')


Theoretical massNumber of molelcules
Total (without water)6,3481
Polymers6,3481
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by software
TypeNameSymmetry operationNumber
identity operation1_5551
Buried area0 Å2
ΔGint0 kcal/mol
Surface area3160 Å2
MethodPISA
NMR ensembles
DataCriteria
Number of conformers (submitted / calculated)10 / 100structures with the lowest energy
RepresentativeModel #1lowest energy

-
Components

#1: DNA chain DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3')


Mass: 6348.070 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)

-
Experimental details

-
Experiment

ExperimentMethod: SOLUTION NMR
NMR experiment
Conditions-IDExperiment-IDSolution-IDSample stateSpectrometer-IDType
111isotropic1H,H jr-NOESY
122isotropic12D 1H-1H NOESY

-
Sample preparation

Details
TypeSolution-IDContentsDetailsLabelSolvent system
solution11 mM DNA, 93% H2O/7% D2O20 mM NaPi, pH 6.8S092 in H2O93% H2O/7% D2O
solution21 mM DNA, 100% D2O20 mM NaPi, pH 6.8S092 in D2O100% D2O
Sample
Conc. (mg/ml)ComponentIsotopic labelingSolution-ID
1 mMDNAnone1
1 mMDNAnone2
Sample conditionsDetails: 20 mM NaPi, pH 6.8 / Ionic strength: 20 mM NaPi mM / Ionic strength err: 0.5 / Label: S092 in H2O / pH: 6.8 pD / PH err: 0.2 / Pressure: 1 atm / Pressure err: 0.2 / Temperature: 293.15 K / Temperature err: 0.2

-
NMR measurement

NMR spectrometerType: Varian VNMRS / Manufacturer: Varian / Model: VNMRS / Field strength: 500 MHz

-
Processing

NMR software
NameDeveloperClassification
FelixAccelrys Software Inc.refinement
Xplor-NIHSchwieters, Kuszewski, Tjandra and Clorestructure calculation
FelixAccelrys Software Inc.chemical shift assignment
RefinementMethod: molecular dynamics / Software ordinal: 2
NMR representativeSelection criteria: lowest energy
NMR ensembleConformer selection criteria: structures with the lowest energy
Conformers calculated total number: 100 / Conformers submitted total number: 10

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbjlvh1.pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more