[English] 日本語
Yorodumi- PDB-2m6w: Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadrup... -
+Open data
-Basic information
Entry | Database: PDB / ID: 2m6w | ||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Title | Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions | ||||||||||||||||||||
Components | DNA (5'-D(*Keywords | DNA / G-Quadruplex / Folding Topology | Function / homology | DNA / DNA (> 10) | Function and homology information Method | SOLUTION NMR / simulated annealing, molecular dynamics | Model details | lowest energy, model1 | Authors | Karsisiotis, A.I. / Webba da Silva, M. | Citation | Journal: Sci Adv / Year: 2018 | Title: Encoding canonical DNA quadruplex structure. Authors: Dvorkin, S.A. / Karsisiotis, A.I. / Webba da Silva, M. History |
|
-Structure visualization
Structure viewer | Molecule: MolmilJmol/JSmol |
---|
-Downloads & links
-Download
PDBx/mmCIF format | 2m6w.cif.gz | 128.8 KB | Display | PDBx/mmCIF format |
---|---|---|---|---|
PDB format | pdb2m6w.ent.gz | 109.2 KB | Display | PDB format |
PDBx/mmJSON format | 2m6w.json.gz | Tree view | PDBx/mmJSON format | |
Others | Other downloads |
-Validation report
Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/m6/2m6w ftp://data.pdbj.org/pub/pdb/validation_reports/m6/2m6w | HTTPS FTP |
---|
-Related structure data
Related structure data | 2m6vC 5j05C 5j4pC 5j4wC 5j6uC C: citing same article (ref.) |
---|---|
Similar structure data | |
Other databases |
-Links
-Assembly
Deposited unit |
| |||||||||
---|---|---|---|---|---|---|---|---|---|---|
1 |
| |||||||||
NMR ensembles |
|
-Components
#1: DNA chain | Mass: 7673.907 Da / Num. of mol.: 1 / Source method: obtained synthetically |
---|
-Experimental details
-Experiment
Experiment | Method: SOLUTION NMR | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NMR experiment |
|
-Sample preparation
Details |
| |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Sample |
| |||||||||||||||||||||||||
Sample conditions |
|
-NMR measurement
NMR spectrometer | Type: Varian VNMRS 500 / Manufacturer: Varian / Model: VNMRS 500 / Field strength: 500 MHz |
---|
-Processing
NMR software |
| ||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Method: simulated annealing, molecular dynamics / Software ordinal: 1 | ||||||||||||||||||||||||||||||
NMR constraints | NOE constraints total: 1024 / NOE intraresidue total count: 496 / NOE long range total count: 209 / NOE medium range total count: 68 / NOE sequential total count: 251 | ||||||||||||||||||||||||||||||
NMR representative | Selection criteria: lowest energy | ||||||||||||||||||||||||||||||
NMR ensemble | Conformer selection criteria: structures with the lowest energy Conformers calculated total number: 100 / Conformers submitted total number: 8 |