[English] 日本語

- PDB-2m6w: Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadrup... -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 2m6w | ||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Title | Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions | ||||||||||||||||||||
![]() | DNA (5'-D(*![]() DNA / G-Quadruplex / Folding Topology | Function / homology | DNA / DNA (> 10) | ![]() Method | SOLUTION NMR / simulated annealing, molecular dynamics | Model details | lowest energy, model1 | ![]() Karsisiotis, A.I. / Webba da Silva, M. | ![]() ![]() Title: Encoding canonical DNA quadruplex structure. Authors: Dvorkin, S.A. / Karsisiotis, A.I. / Webba da Silva, M. History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 129.6 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 109.2 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Summary document | ![]() | 414.5 KB | Display | ![]() |
---|---|---|---|---|
Full document | ![]() | 516.5 KB | Display | |
Data in XML | ![]() | 23.6 KB | Display | |
Data in CIF | ![]() | 25 KB | Display | |
Arichive directory | ![]() ![]() | HTTPS FTP |
-Related structure data
Related structure data | ![]() 2m6vC ![]() 5j05C ![]() 5j4pC ![]() 5j4wC ![]() 5j6uC C: citing same article ( |
---|---|
Similar structure data | |
Other databases |
-
Links
-
Assembly
Deposited unit | ![]()
| |||||||||
---|---|---|---|---|---|---|---|---|---|---|
1 |
| |||||||||
NMR ensembles |
|
-
Components
#1: DNA chain | Mass: 7673.907 Da / Num. of mol.: 1 / Source method: obtained synthetically |
---|
-Experimental details
-Experiment
Experiment | Method: SOLUTION NMR | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NMR experiment |
|
-
Sample preparation
Details |
| |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Sample |
| |||||||||||||||||||||||||
Sample conditions |
|
-NMR measurement
NMR spectrometer | Type: Varian VNMRS 500 / Manufacturer: Varian / Model: VNMRS 500 / Field strength: 500 MHz |
---|
-
Processing
NMR software |
| ||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Method: simulated annealing, molecular dynamics / Software ordinal: 1 | ||||||||||||||||||||||||||||||
NMR constraints | NOE constraints total: 1024 / NOE intraresidue total count: 496 / NOE long range total count: 209 / NOE medium range total count: 68 / NOE sequential total count: 251 | ||||||||||||||||||||||||||||||
NMR representative | Selection criteria: lowest energy | ||||||||||||||||||||||||||||||
NMR ensemble | Conformer selection criteria: structures with the lowest energy Conformers calculated total number: 100 / Conformers submitted total number: 8 |