[English] 日本語
Yorodumi
- PDB-4zcf: Structural basis of asymmetric DNA methylation and ATP-triggered ... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 4zcf
TitleStructural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I
Components
  • (Restriction endonuclease EcoP15I, ...) x 2
  • DNA 20-mer AATCATAGTCTACTGCTGTA
  • DNA 20-mer ATACAGCAGTAGACTATGAT
KeywordsHydrolase-DNA complex / Hydrolase/DNA / ATP motor / DNA methyltransferase / Asymmetric DNA methylation
Function / homology
Function and homology information


type III site-specific deoxyribonuclease / type III site-specific deoxyribonuclease activity / N-methyltransferase activity / site-specific DNA-methyltransferase (adenine-specific) / site-specific DNA-methyltransferase (adenine-specific) activity / DNA restriction-modification system / helicase activity / methylation / DNA binding / ATP binding
Similarity search - Function
Type III R-M EcoP15I, C-terminal / Type III restriction enzyme, C-terminal endonuclease domain / Type III R-M EcoP15I C-terminal domain / Endonuclease domain / N4/N6-methyltransferase, Type III restriction-modification enzyme EcoPI Mod subunit-like / : / DNA methylase N-4/N-6 / DNA methylase / N-6 Adenine-specific DNA methylases signature. / DNA methylase, N-6 adenine-specific, conserved site ...Type III R-M EcoP15I, C-terminal / Type III restriction enzyme, C-terminal endonuclease domain / Type III R-M EcoP15I C-terminal domain / Endonuclease domain / N4/N6-methyltransferase, Type III restriction-modification enzyme EcoPI Mod subunit-like / : / DNA methylase N-4/N-6 / DNA methylase / N-6 Adenine-specific DNA methylases signature. / DNA methylase, N-6 adenine-specific, conserved site / Helicase/UvrB, N-terminal / Type III restriction enzyme, res subunit / S-adenosyl-L-methionine-dependent methyltransferase superfamily / P-loop containing nucleoside triphosphate hydrolase
Similarity search - Domain/homology
ADENOSINE MONOPHOSPHATE / : / DNA / DNA (> 10) / Type III restriction-modification enzyme EcoP15I Mod subunit / Type III restriction-modification enzyme EcoP15I Res subunit
Similarity search - Component
Biological speciesEscherichia coli (E. coli)
MethodX-RAY DIFFRACTION / SYNCHROTRON / MIR / Resolution: 2.6 Å
AuthorsGupta, Y.K. / Chan, S.H. / Xu, S.Y. / Aggarwal, A.K.
Funding support United States, 1items
OrganizationGrant numberCountry
National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)R01 GM111507 United States
CitationJournal: Nat Commun / Year: 2015
Title: Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I.
Authors: Gupta, Y.K. / Chan, S.H. / Xu, S.Y. / Aggarwal, A.K.
History
DepositionApr 15, 2015Deposition site: RCSB / Processing site: RCSB
Revision 1.0Jul 29, 2015Provider: repository / Type: Initial release
Revision 1.1Sep 20, 2017Group: Author supporting evidence / Derived calculations / Source and taxonomy
Category: entity_src_gen / pdbx_audit_support ...entity_src_gen / pdbx_audit_support / pdbx_entity_src_syn / pdbx_struct_oper_list
Item: _entity_src_gen.pdbx_alt_source_flag / _pdbx_audit_support.funding_organization ..._entity_src_gen.pdbx_alt_source_flag / _pdbx_audit_support.funding_organization / _pdbx_entity_src_syn.pdbx_alt_source_flag / _pdbx_struct_oper_list.symmetry_operation
Revision 1.2Dec 25, 2019Group: Author supporting evidence / Category: pdbx_audit_support / Item: _pdbx_audit_support.funding_organization
Revision 2.0Jan 20, 2021Group: Derived calculations / Polymer sequence
Category: entity_poly / pdbx_struct_conn_angle / struct_conn
Item: _entity_poly.type / _pdbx_struct_conn_angle.ptnr1_auth_asym_id ..._entity_poly.type / _pdbx_struct_conn_angle.ptnr1_auth_asym_id / _pdbx_struct_conn_angle.ptnr1_auth_comp_id / _pdbx_struct_conn_angle.ptnr1_auth_seq_id / _pdbx_struct_conn_angle.ptnr1_label_asym_id / _pdbx_struct_conn_angle.ptnr1_label_atom_id / _pdbx_struct_conn_angle.ptnr1_label_comp_id / _pdbx_struct_conn_angle.ptnr1_label_seq_id / _pdbx_struct_conn_angle.ptnr3_auth_asym_id / _pdbx_struct_conn_angle.ptnr3_auth_comp_id / _pdbx_struct_conn_angle.ptnr3_auth_seq_id / _pdbx_struct_conn_angle.ptnr3_label_asym_id / _pdbx_struct_conn_angle.ptnr3_label_atom_id / _pdbx_struct_conn_angle.ptnr3_label_comp_id / _pdbx_struct_conn_angle.ptnr3_label_seq_id / _pdbx_struct_conn_angle.value / _struct_conn.pdbx_dist_value / _struct_conn.ptnr1_auth_asym_id / _struct_conn.ptnr1_auth_comp_id / _struct_conn.ptnr1_auth_seq_id / _struct_conn.ptnr1_label_asym_id / _struct_conn.ptnr1_label_atom_id / _struct_conn.ptnr1_label_comp_id / _struct_conn.ptnr1_label_seq_id / _struct_conn.ptnr2_auth_asym_id / _struct_conn.ptnr2_auth_comp_id / _struct_conn.ptnr2_auth_seq_id / _struct_conn.ptnr2_label_asym_id / _struct_conn.ptnr2_label_atom_id / _struct_conn.ptnr2_label_comp_id / _struct_conn.ptnr2_label_seq_id
Revision 2.1Mar 6, 2024Group: Data collection / Database references / Category: chem_comp_atom / chem_comp_bond / database_2
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Restriction endonuclease EcoP15I, modification subunit
B: Restriction endonuclease EcoP15I, modification subunit
C: Restriction endonuclease EcoP15I, restriction subunit
D: DNA 20-mer ATACAGCAGTAGACTATGAT
E: DNA 20-mer AATCATAGTCTACTGCTGTA
hetero molecules


Theoretical massNumber of molelcules
Total (without water)272,2629
Polymers271,7655
Non-polymers4974
Water1,71195
1


  • Idetical with deposited unit
  • defined by author&software
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area22000 Å2
ΔGint-113 kcal/mol
Surface area83990 Å2
MethodPISA
Unit cell
Length a, b, c (Å)101.838, 101.838, 533.031
Angle α, β, γ (deg.)90.00, 90.00, 90.00
Int Tables number92
Space group name H-MP41212

-
Components

-
Restriction endonuclease EcoP15I, ... , 2 types, 3 molecules ABC

#1: Protein Restriction endonuclease EcoP15I, modification subunit


Mass: 74190.719 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (E. coli) / Gene: ecoP15Imod / Production host: Escherichia coli (E. coli) / Strain (production host): NEB Express / References: UniProt: Q5ZND1
#2: Protein Restriction endonuclease EcoP15I, restriction subunit


Mass: 111109.641 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (E. coli) / Gene: ecoP15Ires / Production host: Escherichia coli (E. coli) / Strain (production host): NEB Express / References: UniProt: Q5ZND2

-
DNA chain , 2 types, 2 molecules DE

#3: DNA chain DNA 20-mer ATACAGCAGTAGACTATGAT


Mass: 6166.030 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) Escherichia coli (E. coli)
#4: DNA chain DNA 20-mer AATCATAGTCTACTGCTGTA


Mass: 6107.978 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) Escherichia coli (E. coli)

-
Non-polymers , 4 types, 99 molecules

#5: Chemical ChemComp-MN / MANGANESE (II) ION


Mass: 54.938 Da / Num. of mol.: 2 / Source method: obtained synthetically / Formula: Mn
#6: Chemical ChemComp-AMP / ADENOSINE MONOPHOSPHATE


Mass: 347.221 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: C10H14N5O7P / Comment: AMP*YM
#7: Chemical ChemComp-CA / CALCIUM ION


Mass: 40.078 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: Ca
#8: Water ChemComp-HOH / water


Mass: 18.015 Da / Num. of mol.: 95 / Source method: isolated from a natural source / Formula: H2O

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION

-
Sample preparation

CrystalDensity Matthews: 2.54 Å3/Da / Density % sol: 51.55 %
Crystal growTemperature: 293 K / Method: vapor diffusion, hanging drop / pH: 7.5 / Details: PEG 5000 monomethylether, potassium acetate, HEPES / PH range: 7.2-7.6

-
Data collection

DiffractionMean temperature: 100 K
Diffraction sourceSource: SYNCHROTRON / Site: APS / Beamline: 24-ID-C / Wavelength: 0.9795 Å
DetectorType: DECTRIS PILATUS 6M / Detector: PIXEL / Date: Feb 21, 2013
RadiationMonochromator: Si(111) / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 0.9795 Å / Relative weight: 1
ReflectionResolution: 2.6→50 Å / Num. obs: 85834 / % possible obs: 97.3 % / Redundancy: 15.1 % / Biso Wilson estimate: 73.1 Å2 / Rsym value: 0.11 / Net I/σ(I): 15.5
Reflection shellHighest resolution: 2.6 Å / Redundancy: 15 % / Rmerge(I) obs: 0.72 / Mean I/σ(I) obs: 3.4 / % possible all: 94.5

-
Processing

Software
NameVersionClassification
BUSTER2.10.0refinement
XDSdata reduction
SCALAdata scaling
SHARPphasing
RefinementMethod to determine structure: MIR / Resolution: 2.6→40 Å / Cor.coef. Fo:Fc: 0.9142 / Cor.coef. Fo:Fc free: 0.8813 / SU R Cruickshank DPI: 0.433 / Cross valid method: THROUGHOUT / σ(F): 0 / SU R Blow DPI: 0.43 / SU Rfree Blow DPI: 0.282 / SU Rfree Cruickshank DPI: 0.287
RfactorNum. reflection% reflectionSelection details
Rfree0.2625 4321 5.04 %RANDOM
Rwork0.2183 ---
obs0.2206 85658 97.45 %-
Displacement parametersBiso mean: 59.93 Å2
Baniso -1Baniso -2Baniso -3
1--4.4567 Å20 Å20 Å2
2---4.4567 Å20 Å2
3---8.9133 Å2
Refine analyzeLuzzati coordinate error obs: 0.389 Å
Refinement stepCycle: LAST / Resolution: 2.6→40 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms13995 818 26 95 14934
Refine LS restraints
Refine-IDTypeDev idealNumberRestraint functionWeight
X-RAY DIFFRACTIONt_bond_d0.0115193HARMONIC2
X-RAY DIFFRACTIONt_angle_deg1.2520776HARMONIC2
X-RAY DIFFRACTIONt_dihedral_angle_d5162SINUSOIDAL2
X-RAY DIFFRACTIONt_incorr_chiral_ct
X-RAY DIFFRACTIONt_pseud_angle
X-RAY DIFFRACTIONt_trig_c_planes348HARMONIC2
X-RAY DIFFRACTIONt_gen_planes2128HARMONIC5
X-RAY DIFFRACTIONt_it15193HARMONIC20
X-RAY DIFFRACTIONt_nbd2SEMIHARMONIC5
X-RAY DIFFRACTIONt_omega_torsion2.78
X-RAY DIFFRACTIONt_other_torsion20.3
X-RAY DIFFRACTIONt_improper_torsion
X-RAY DIFFRACTIONt_chiral_improper_torsion2090SEMIHARMONIC5
X-RAY DIFFRACTIONt_sum_occupancies
X-RAY DIFFRACTIONt_utility_distance
X-RAY DIFFRACTIONt_utility_angle
X-RAY DIFFRACTIONt_utility_torsion
X-RAY DIFFRACTIONt_ideal_dist_contact16288SEMIHARMONIC4
LS refinement shellResolution: 2.6→2.67 Å / Total num. of bins used: 20
RfactorNum. reflection% reflection
Rfree0.3468 295 4.81 %
Rwork0.2712 5835 -
all0.2748 6130 -
obs--97.45 %

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242)：Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more