[English] 日本語
Yorodumi
- PDB-4ihv: Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTG... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 4ihv
TitleCrystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
Components
  • 27-bp DNA Strand A
  • 27-bp DNA Strand B
  • DNA-binding protein fis
KeywordsTRANSCRIPTION/DNA / Protein-DNA complex / HTH domain / minor groove compression / DNA bending / indirect recognition / TRANSCRIPTION-DNA complex
Function / homologyHomeodomain-like / Arc Repressor Mutant, subunit A / Orthogonal Bundle / Mainly Alpha / DNA / DNA (> 10) / :
Function and homology information
Biological speciesEscherichia coli (E. coli)
MethodX-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / molecular replacement / Resolution: 2.716 Å
AuthorsHancock, S.P. / Cascio, D. / Johnson, R.C.
CitationJournal: Nucleic Acids Res. / Year: 2013
Title: Control of DNA minor groove width and Fis protein binding by the purine 2-amino group.
Authors: Hancock, S.P. / Ghane, T. / Cascio, D. / Rohs, R. / Di Felice, R. / Johnson, R.C.
History
DepositionDec 19, 2012Deposition site: RCSB / Processing site: RCSB
Revision 1.0May 1, 2013Provider: repository / Type: Initial release
Revision 1.1May 22, 2013Group: Database references
Revision 1.2Jul 31, 2013Group: Database references
Revision 1.3Sep 20, 2023Group: Data collection / Database references / Refinement description
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / database_2 / pdbx_initial_refinement_model
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: DNA-binding protein fis
B: DNA-binding protein fis
C: 27-bp DNA Strand A
D: 27-bp DNA Strand B


Theoretical massNumber of molelcules
Total (without water)39,0944
Polymers39,0944
Non-polymers00
Water905
1


  • Idetical with deposited unit
  • defined by author&software
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area8780 Å2
ΔGint-65 kcal/mol
Surface area19030 Å2
MethodPISA
Unit cell
Length a, b, c (Å)42.790, 89.390, 154.150
Angle α, β, γ (deg.)90.000, 90.000, 90.000
Int Tables number19
Space group name H-MP212121

-
Components

#1: Protein DNA-binding protein fis / Factor for Inversion Stimulation


Mass: 11252.918 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (E. coli) / Strain: K-12 / Gene: ECDH1ME8569_3147, EcDH1_0445, fis / Plasmid: pET11a / Production host: Escherichia coli (E. coli) / Strain (production host): BL21(DE3) / References: UniProt: C9QXL3
#2: DNA chain 27-bp DNA Strand A


Mass: 8360.416 Da / Num. of mol.: 1 / Source method: obtained synthetically
#3: DNA chain 27-bp DNA Strand B


Mass: 8227.362 Da / Num. of mol.: 1 / Source method: obtained synthetically
#4: Water ChemComp-HOH / water


Mass: 18.015 Da / Num. of mol.: 5 / Source method: isolated from a natural source / Formula: H2O

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 1

-
Sample preparation

CrystalDensity Matthews: 3.77 Å3/Da / Density % sol: 67.38 %
Crystal growTemperature: 277 K / Method: vapor diffusion, hanging drop / pH: 8.5
Details: 0.2 M sodium citrate, 0.1 M Tris-HCl, pH 8.5, 36% PEG400, VAPOR DIFFUSION, HANGING DROP, temperature 277K

-
Data collection

DiffractionMean temperature: 100 K
Diffraction sourceSource: SYNCHROTRON / Site: APS / Beamline: 24-ID-C / Wavelength: 0.92017 Å
DetectorType: ADSC QUANTUM 315 / Detector: CCD / Date: Jul 24, 2011
RadiationMonochromator: double crystal Si(111) / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 0.92017 Å / Relative weight: 1
ReflectionResolution: 2.716→100 Å / Num. obs: 16603 / % possible obs: 99.6 % / Observed criterion σ(I): -3 / Redundancy: 6.99 % / Biso Wilson estimate: 63.279 Å2 / Rmerge(I) obs: 0.082 / Net I/σ(I): 16.06
Reflection shell

Diffraction-ID: 1

Resolution (Å)Highest resolution (Å)Rmerge(I) obsMean I/σ(I) obsNum. measured obsNum. unique obs% possible all
2.716-2.790.882.388028117397.5
2.79-2.860.7093.0287731194100
2.86-2.950.5573.9482211117100
2.95-3.040.4225.181861125100
3.04-3.140.2877.117769106799.8
3.14-3.250.18110.4376331057100
3.25-3.370.14612.24714699599.9
3.37-3.510.10915.67703098499.9
3.51-3.660.09717.66743948100
3.66-3.840.08120.05632889599.9
3.84-4.050.0722.93597685699.8
4.05-4.290.06125.5575683799.6
4.29-4.590.05427.515157754100
4.59-4.960.05227.39494472799.9
4.96-5.430.05228.1436565999.7
5.43-6.070.05327.97399761699.5
6.07-7.010.04630.05350753999.8
7.01-8.590.03733.64308847499.8
8.59-12.150.03334.91226536799.2
12.150.03431.91118621994

-
Phasing

PhasingMethod: molecular replacement
Phasing MRModel details: Phaser MODE: MR_AUTO
Highest resolutionLowest resolution
Rotation7.43 Å77.08 Å
Translation7.43 Å77.08 Å

-
Processing

Software
NameVersionClassificationNB
XSCALEdata scaling
PHASER2.5.1phasing
PHENIX1.8_1069refinement
PDB_EXTRACT3.11data extraction
XDSdata reduction
RefinementMethod to determine structure: MOLECULAR REPLACEMENT
Starting model: PDB ENTRY 3IV5

3iv5


Resolution: 2.716→42.927 Å / Occupancy max: 1 / Occupancy min: 1 / FOM work R set: 0.7835 / SU ML: 0.37 / Cross valid method: THROUGHOUT / σ(F): 2 / Phase error: 27.5 / Stereochemistry target values: ML
RfactorNum. reflection% reflectionSelection details
Rfree0.2575 1659 10.01 %RANDOM
Rwork0.2169 ---
obs0.221 16577 99.48 %-
Solvent computationShrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL
Displacement parametersBiso max: 105.7 Å2 / Biso mean: 38.3474 Å2 / Biso min: 8.42 Å2
Refinement stepCycle: LAST / Resolution: 2.716→42.927 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms1505 1101 0 5 2611
Refine LS restraints
Refine-IDTypeDev idealNumber
X-RAY DIFFRACTIONf_bond_d0.0082752
X-RAY DIFFRACTIONf_angle_d1.4913942
X-RAY DIFFRACTIONf_chiral_restr0.075450
X-RAY DIFFRACTIONf_plane_restr0.004320
X-RAY DIFFRACTIONf_dihedral_angle_d26.3361128
LS refinement shell

Refine-ID: X-RAY DIFFRACTION / Total num. of bins used: 12

Resolution (Å)Rfactor RfreeNum. reflection RfreeRfactor RworkNum. reflection RworkNum. reflection all% reflection obs (%)
2.716-2.7960.3491320.29861182131498
2.796-2.88620.34141370.27712321369100
2.8862-2.98930.3011350.263112161351100
2.9893-3.1090.30371360.258812291365100
3.109-3.25040.271360.230512171353100
3.2504-3.42170.26221370.226112411378100
3.4217-3.6360.24971380.208212431381100
3.636-3.91660.26441390.220812511390100
3.9166-4.31040.27771380.208512411379100
4.3104-4.93340.2511400.196212531393100
4.9334-6.21250.25231420.205612781420100
6.2125-42.93240.19821490.19821335148498

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242)：Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more