[English] 日本語
Yorodumi- PDB-4ihv: Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTG... -
+Open data
-Basic information
Entry | Database: PDB / ID: 4ihv | ||||||
---|---|---|---|---|---|---|---|
Title | Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT) | ||||||
Components |
| ||||||
Keywords | TRANSCRIPTION/DNA / Protein-DNA complex / HTH domain / minor groove compression / DNA bending / indirect recognition / TRANSCRIPTION-DNA complex | ||||||
Function / homology | Homeodomain-like / Arc Repressor Mutant, subunit A / Orthogonal Bundle / Mainly Alpha / DNA / DNA (> 10) / : Function and homology information | ||||||
Biological species | Escherichia coli (E. coli) | ||||||
Method | X-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / molecular replacement / Resolution: 2.716 Å | ||||||
Authors | Hancock, S.P. / Cascio, D. / Johnson, R.C. | ||||||
Citation | Journal: Nucleic Acids Res. / Year: 2013 Title: Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Authors: Hancock, S.P. / Ghane, T. / Cascio, D. / Rohs, R. / Di Felice, R. / Johnson, R.C. | ||||||
History |
|
-Structure visualization
Structure viewer | Molecule: MolmilJmol/JSmol |
---|
-Downloads & links
-Download
PDBx/mmCIF format | 4ihv.cif.gz | 81.5 KB | Display | PDBx/mmCIF format |
---|---|---|---|---|
PDB format | pdb4ihv.ent.gz | 57.5 KB | Display | PDB format |
PDBx/mmJSON format | 4ihv.json.gz | Tree view | PDBx/mmJSON format | |
Others | Other downloads |
-Validation report
Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/ih/4ihv ftp://data.pdbj.org/pub/pdb/validation_reports/ih/4ihv | HTTPS FTP |
---|
-Related structure data
Related structure data | 4ihwC 4ihxC 4ihyC 3iv5S C: citing same article (ref.) S: Starting model for refinement |
---|---|
Similar structure data |
-Links
-Assembly
Deposited unit |
| ||||||||
---|---|---|---|---|---|---|---|---|---|
1 |
| ||||||||
Unit cell |
|
-Components
#1: Protein | Mass: 11252.918 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Escherichia coli (E. coli) / Strain: K-12 / Gene: ECDH1ME8569_3147, EcDH1_0445, fis / Plasmid: pET11a / Production host: Escherichia coli (E. coli) / Strain (production host): BL21(DE3) / References: UniProt: C9QXL3 #2: DNA chain | | Mass: 8360.416 Da / Num. of mol.: 1 / Source method: obtained synthetically #3: DNA chain | | Mass: 8227.362 Da / Num. of mol.: 1 / Source method: obtained synthetically #4: Water | ChemComp-HOH / | |
---|
-Experimental details
-Experiment
Experiment | Method: X-RAY DIFFRACTION / Number of used crystals: 1 |
---|
-Sample preparation
Crystal | Density Matthews: 3.77 Å3/Da / Density % sol: 67.38 % |
---|---|
Crystal grow | Temperature: 277 K / Method: vapor diffusion, hanging drop / pH: 8.5 Details: 0.2 M sodium citrate, 0.1 M Tris-HCl, pH 8.5, 36% PEG400, VAPOR DIFFUSION, HANGING DROP, temperature 277K |
-Data collection
Diffraction | Mean temperature: 100 K | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Diffraction source | Source: SYNCHROTRON / Site: APS / Beamline: 24-ID-C / Wavelength: 0.92017 Å | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Detector | Type: ADSC QUANTUM 315 / Detector: CCD / Date: Jul 24, 2011 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Radiation | Monochromator: double crystal Si(111) / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Radiation wavelength | Wavelength: 0.92017 Å / Relative weight: 1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Reflection | Resolution: 2.716→100 Å / Num. obs: 16603 / % possible obs: 99.6 % / Observed criterion σ(I): -3 / Redundancy: 6.99 % / Biso Wilson estimate: 63.279 Å2 / Rmerge(I) obs: 0.082 / Net I/σ(I): 16.06 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Reflection shell | Diffraction-ID: 1
|
-Phasing
Phasing | Method: molecular replacement | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Phasing MR | Model details: Phaser MODE: MR_AUTO
|
-Processing
Software |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Method to determine structure: MOLECULAR REPLACEMENT Starting model: PDB ENTRY 3IV5 Resolution: 2.716→42.927 Å / Occupancy max: 1 / Occupancy min: 1 / FOM work R set: 0.7835 / SU ML: 0.37 / Cross valid method: THROUGHOUT / σ(F): 2 / Phase error: 27.5 / Stereochemistry target values: ML
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Solvent computation | Shrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Displacement parameters | Biso max: 105.7 Å2 / Biso mean: 38.3474 Å2 / Biso min: 8.42 Å2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement step | Cycle: LAST / Resolution: 2.716→42.927 Å
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refine LS restraints |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
LS refinement shell | Refine-ID: X-RAY DIFFRACTION / Total num. of bins used: 12
|