[English] 日本語
Yorodumi
- PDB-5e3n: Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTT... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 5e3n
TitleCrystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)
Components
  • (DNA (27-MER)) x 2
  • DNA-binding protein Fis
KeywordsDNA BINDING PROTEIN/DNA / Protein-DNA complex / HTH domain / DNA bending / indirect recognition / DNA BINDING PROTEIN-DNA complex
Function / homology
Function and homology information


invertasome / positive regulation of DNA recombination / sequence-specific DNA binding, bending / provirus excision / nucleoid / DNA-binding transcription repressor activity / chromosome organization / DNA-binding transcription activator activity / core promoter sequence-specific DNA binding / protein-DNA complex ...invertasome / positive regulation of DNA recombination / sequence-specific DNA binding, bending / provirus excision / nucleoid / DNA-binding transcription repressor activity / chromosome organization / DNA-binding transcription activator activity / core promoter sequence-specific DNA binding / protein-DNA complex / response to radiation / nucleosome / sequence-specific DNA binding / transcription cis-regulatory region binding / regulation of DNA-templated transcription / protein homodimerization activity / DNA binding / DNA-templated transcription / cytosol
Similarity search - Function
DNA-binding protein Fis N-terminal domain / DNA-binding protein Fis / NtrC-type HTH DNA-binding domain profile. / DNA binding HTH domain, Fis-type / Bacterial regulatory protein, Fis family / Homeodomain-like / Homeobox-like domain superfamily / Arc Repressor Mutant, subunit A / Orthogonal Bundle / Mainly Alpha
Similarity search - Domain/homology
DNA / DNA (> 10) / DNA-binding protein Fis
Similarity search - Component
Biological speciesEscherichia coli (E. coli)
synthetic construct (others)
MethodX-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / molecular replacement / Resolution: 2.66 Å
AuthorsHancock, S.P. / Cascio, D. / Johnson, R.C.
Funding support United States, 1items
OrganizationGrant numberCountry
National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)GM038509 United States
CitationJournal: Plos One / Year: 2016
Title: DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Authors: Hancock, S.P. / Stella, S. / Cascio, D. / Johnson, R.C.
History
DepositionOct 3, 2015Deposition site: RCSB / Processing site: RCSB
Revision 1.0Mar 9, 2016Provider: repository / Type: Initial release
Revision 1.1Mar 23, 2016Group: Database references
Revision 1.2Mar 23, 2022Group: Author supporting evidence / Data collection ...Author supporting evidence / Data collection / Database references / Derived calculations
Category: database_2 / diffrn_radiation_wavelength ...database_2 / diffrn_radiation_wavelength / pdbx_audit_support / pdbx_struct_oper_list
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession ..._database_2.pdbx_DOI / _database_2.pdbx_database_accession / _pdbx_audit_support.funding_organization / _pdbx_audit_support.grant_number / _pdbx_struct_oper_list.symmetry_operation
Revision 1.3May 22, 2024Group: Data collection / Refinement description
Category: chem_comp_atom / chem_comp_bond / struct_ncs_dom_lim
Item: _struct_ncs_dom_lim.beg_auth_comp_id / _struct_ncs_dom_lim.beg_label_asym_id ..._struct_ncs_dom_lim.beg_auth_comp_id / _struct_ncs_dom_lim.beg_label_asym_id / _struct_ncs_dom_lim.beg_label_comp_id / _struct_ncs_dom_lim.beg_label_seq_id / _struct_ncs_dom_lim.end_auth_comp_id / _struct_ncs_dom_lim.end_label_asym_id / _struct_ncs_dom_lim.end_label_comp_id / _struct_ncs_dom_lim.end_label_seq_id

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: DNA-binding protein Fis
B: DNA-binding protein Fis
C: DNA (27-MER)
D: DNA (27-MER)


Theoretical massNumber of molelcules
Total (without water)39,0924
Polymers39,0924
Non-polymers00
Water1629
1


  • Idetical with deposited unit
  • defined by author&software
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area8750 Å2
ΔGint-60 kcal/mol
Surface area19160 Å2
MethodPISA
Unit cell
Length a, b, c (Å)43.190, 92.980, 153.940
Angle α, β, γ (deg.)90.000, 90.000, 90.000
Int Tables number19
Space group name H-MP212121
Noncrystallographic symmetry (NCS)NCS domain:
IDEns-IDDetails (eV)
11chain A
21chain B
12chain C
22chain D

NCS domain segments:

Component-ID: 1

Dom-IDEns-IDBeg auth comp-IDBeg label comp-IDEnd auth comp-IDEnd label comp-IDSelection detailsAuth asym-IDLabel asym-IDAuth seq-IDLabel seq-ID
11SERSERASNASNchain AAA8 - 988 - 98
21METMETASNASNchain BBB1 - 981 - 98
12DADADTDTchain CCC1 - 271 - 27
22DADADTDTchain DDD1 - 271 - 27

NCS ensembles :
ID
1
2

-
Components

#1: Protein DNA-binding protein Fis / Factor-for-inversion stimulation protein / Hin recombinational enhancer-binding protein


Mass: 11252.918 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (E. coli) / Strain: K12 / Gene: fis, b3261, JW3229 / Plasmid: pET11a / Production host: Escherichia coli (E. coli) / Strain (production host): BL21(DE3) / References: UniProt: P0A6R3
#2: DNA chain DNA (27-MER)


Mass: 8319.403 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)
#3: DNA chain DNA (27-MER)


Mass: 8266.397 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)
#4: Water ChemComp-HOH / water


Mass: 18.015 Da / Num. of mol.: 9 / Source method: isolated from a natural source / Formula: H2O

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 1

-
Sample preparation

CrystalDensity Matthews: 3.95 Å3/Da / Density % sol: 68.89 %
Crystal growTemperature: 277 K / Method: vapor diffusion, hanging drop / pH: 8.5
Details: 0.2 M Sodium citrate, 0.1 M TRIS-HCl pH 8.5, 36% PEG 400

-
Data collection

DiffractionMean temperature: 100 K
Diffraction sourceSource: SYNCHROTRON / Site: APS / Beamline: 24-ID-C / Wavelength: 0.97949 Å
DetectorType: ADSC QUANTUM 315 / Detector: CCD / Date: Mar 5, 2011
RadiationMonochromator: Si (111) / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 0.97949 Å / Relative weight: 1
ReflectionResolution: 2.66→92.98 Å / Num. obs: 18640 / % possible obs: 99.9 % / Redundancy: 7.6 % / Biso Wilson estimate: 29.84 Å2 / CC1/2: 0.996 / Rmerge(I) obs: 0.098 / Rpim(I) all: 0.038 / Net I/σ(I): 10.3 / Num. measured all: 142367 / Scaling rejects: 267
Reflection shell

Diffraction-ID: 1 / Rejects: _

Resolution (Å)Redundancy (%)Rmerge(I) obsMean I/σ(I) obsNum. measured allNum. unique allCC1/2Rpim(I) all% possible all
2.66-2.87.30.622.51935726640.9180.24199.9
8.4-92.986.50.06117.643596750.9940.02698.8

-
Phasing

PhasingMethod: molecular replacement

-
Processing

Software
NameVersionClassification
Aimless0.5.14data scaling
PHASER2.2.1phasing
PHENIX(phenix.refine: 1.9_1692)refinement
PDB_EXTRACT3.15data extraction
RefinementMethod to determine structure: MOLECULAR REPLACEMENT / Resolution: 2.66→39.794 Å / SU ML: 0.28 / Cross valid method: FREE R-VALUE / σ(F): 1.36 / Phase error: 24.98 / Stereochemistry target values: ML
RfactorNum. reflection% reflection
Rfree0.2523 892 5.05 %
Rwork0.2166 16766 -
obs0.2184 17658 95.08 %
Solvent computationShrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL
Displacement parametersBiso max: 130.28 Å2 / Biso mean: 38.7081 Å2 / Biso min: 6.55 Å2
Refinement stepCycle: final / Resolution: 2.66→39.794 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms1505 1101 0 9 2615
Biso mean---19.09 -
Num. residues----243
Refine LS restraints
Refine-IDTypeDev idealNumber
X-RAY DIFFRACTIONf_bond_d0.0142766
X-RAY DIFFRACTIONf_angle_d1.1313942
X-RAY DIFFRACTIONf_chiral_restr0.044450
X-RAY DIFFRACTIONf_plane_restr0.005320
X-RAY DIFFRACTIONf_dihedral_angle_d24.3221128
Refine LS restraints NCS
Ens-IDDom-IDAuth asym-IDNumberRefine-IDRmsType
11A1096X-RAY DIFFRACTION9.976TORSIONAL
12B1096X-RAY DIFFRACTION9.976TORSIONAL
21C442X-RAY DIFFRACTION9.976TORSIONAL
22D442X-RAY DIFFRACTION9.976TORSIONAL
LS refinement shell

Refine-ID: X-RAY DIFFRACTION / Total num. of bins used: 6

Resolution (Å)Rfactor RfreeNum. reflection RfreeRfactor RworkNum. reflection RworkNum. reflection all% reflection obs (%)
2.659-2.82560.3131100.28432014212470
2.8256-3.04370.32461610.274828853046100
3.0437-3.34980.28321480.250829123060100
3.3498-3.83420.22391430.212729253068100
3.8342-4.82930.22731670.18329493116100
4.8293-39.79890.2231630.18253081324499
Refinement TLS params.Method: refined / Origin x: -11.061 Å / Origin y: 1.7376 Å / Origin z: -5.5781 Å
111213212223313233
T0.2283 Å2-0.0234 Å2-0.0377 Å2-0.1984 Å20.0158 Å2--0.0935 Å2
L1.1684 °20.0429 °20.367 °2-0.6308 °2-0.0575 °2--1.6921 °2
S0.0497 Å °0.0758 Å °-0.2209 Å °-0.0926 Å °0.0963 Å °-0.0053 Å °0.6558 Å °-0.0591 Å °-0.0902 Å °
Refinement TLS group
IDRefine-IDRefine TLS-IDSelection detailsAuth asym-IDAuth seq-ID
1X-RAY DIFFRACTION1allA8 - 98
2X-RAY DIFFRACTION1allB1 - 98
3X-RAY DIFFRACTION1allB99 - 103
4X-RAY DIFFRACTION1allC1 - 27
5X-RAY DIFFRACTION1allC28
6X-RAY DIFFRACTION1allD1 - 27
7X-RAY DIFFRACTION1allE1 - 4

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more