[English] 日本語
Yorodumi- PDB-5e3o: Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTT... -
+Open data
-Basic information
Entry | Database: PDB / ID: 5e3o | ||||||
---|---|---|---|---|---|---|---|
Title | Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT) | ||||||
Components |
| ||||||
Keywords | DNA BINDING PROTEIN/DNA / Protein-DNA complex / HTH domain / DNA bending / indirect recognition / DNA BINDING PROTEIN-DNA complex | ||||||
Function / homology | Function and homology information invertasome / positive regulation of DNA recombination / sequence-specific DNA binding, bending / provirus excision / nucleoid / DNA-binding transcription repressor activity / DNA-binding transcription activator activity / chromosome organization / core promoter sequence-specific DNA binding / protein-DNA complex ...invertasome / positive regulation of DNA recombination / sequence-specific DNA binding, bending / provirus excision / nucleoid / DNA-binding transcription repressor activity / DNA-binding transcription activator activity / chromosome organization / core promoter sequence-specific DNA binding / protein-DNA complex / response to radiation / nucleosome / sequence-specific DNA binding / transcription cis-regulatory region binding / DNA-templated transcription / regulation of DNA-templated transcription / protein homodimerization activity / DNA binding / cytosol Similarity search - Function | ||||||
Biological species | Escherichia coli (E. coli) synthetic construct (others) | ||||||
Method | X-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / molecular replacement / Resolution: 2.78 Å | ||||||
Authors | Hancock, S.P. / Cascio, D. / Johnson, R.C. | ||||||
Citation | Journal: Plos One / Year: 2016 Title: DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Authors: Hancock, S.P. / Stella, S. / Cascio, D. / Johnson, R.C. | ||||||
History |
|
-Structure visualization
Structure viewer | Molecule: MolmilJmol/JSmol |
---|
-Downloads & links
-Download
PDBx/mmCIF format | 5e3o.cif.gz | 144.7 KB | Display | PDBx/mmCIF format |
---|---|---|---|---|
PDB format | pdb5e3o.ent.gz | 111.3 KB | Display | PDB format |
PDBx/mmJSON format | 5e3o.json.gz | Tree view | PDBx/mmJSON format | |
Others | Other downloads |
-Validation report
Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/e3/5e3o ftp://data.pdbj.org/pub/pdb/validation_reports/e3/5e3o | HTTPS FTP |
---|
-Related structure data
-Links
-Assembly
Deposited unit |
| ||||||||
---|---|---|---|---|---|---|---|---|---|
1 |
| ||||||||
Unit cell |
|
-Components
#1: Protein | Mass: 11252.918 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Escherichia coli (E. coli) / Strain: K12 / Gene: fis, b3261, JW3229 / Plasmid: pET11a / Production host: Escherichia coli (E. coli) / Strain (production host): BL21(DE3) / References: UniProt: P0A6R3 #2: DNA chain | | Mass: 8304.393 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others) #3: DNA chain | | Mass: 8282.396 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others) #4: Water | ChemComp-HOH / | |
---|
-Experimental details
-Experiment
Experiment | Method: X-RAY DIFFRACTION / Number of used crystals: 1 |
---|
-Sample preparation
Crystal | Density Matthews: 4.02 Å3/Da / Density % sol: 69.41 % |
---|---|
Crystal grow | Temperature: 277 K / Method: vapor diffusion, hanging drop / pH: 8.5 Details: 0.2 M Sodium citrate, 0.1 M TRIS-HCl pH 8.5, 36% PEG 400 |
-Data collection
Diffraction | Mean temperature: 100 K | |||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Diffraction source | Source: SYNCHROTRON / Site: APS / Beamline: 24-ID-C / Wavelength: 0.97949 Å | |||||||||||||||||||||||||||
Detector | Type: ADSC QUANTUM 315 / Detector: CCD / Date: Mar 5, 2011 | |||||||||||||||||||||||||||
Radiation | Monochromator: Si (111) / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray | |||||||||||||||||||||||||||
Radiation wavelength | Wavelength: 0.97949 Å / Relative weight: 1 | |||||||||||||||||||||||||||
Reflection | Resolution: 2.78→80.48 Å / Num. obs: 15712 / % possible obs: 94.3 % / Redundancy: 5.1 % / Biso Wilson estimate: 39.23 Å2 / CC1/2: 0.998 / Rmerge(I) obs: 0.071 / Rpim(I) all: 0.035 / Net I/σ(I): 13.8 / Num. measured all: 80167 / Scaling rejects: 14 | |||||||||||||||||||||||||||
Reflection shell | Diffraction-ID: 1 / Rejects: 0
|
-Phasing
Phasing | Method: molecular replacement |
---|
-Processing
Software |
| ||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Method to determine structure: MOLECULAR REPLACEMENT / Resolution: 2.78→59.727 Å / SU ML: 0.36 / Cross valid method: FREE R-VALUE / σ(F): 1.34 / Phase error: 27.23 / Stereochemistry target values: ML
| ||||||||||||||||||||||||||||||||||||||||||
Solvent computation | Shrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL | ||||||||||||||||||||||||||||||||||||||||||
Displacement parameters | Biso max: 149.34 Å2 / Biso mean: 43.9852 Å2 / Biso min: 9.41 Å2 | ||||||||||||||||||||||||||||||||||||||||||
Refinement step | Cycle: final / Resolution: 2.78→59.727 Å
| ||||||||||||||||||||||||||||||||||||||||||
Refine LS restraints |
| ||||||||||||||||||||||||||||||||||||||||||
LS refinement shell | Refine-ID: X-RAY DIFFRACTION / Total num. of bins used: 5
| ||||||||||||||||||||||||||||||||||||||||||
Refinement TLS params. | Method: refined / Origin x: -11.0468 Å / Origin y: 1.9724 Å / Origin z: -5.5341 Å
| ||||||||||||||||||||||||||||||||||||||||||
Refinement TLS group |
|