[English] 日本語
![](img/lk-miru.gif)
- PDB-5dtd: Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATT... -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 5dtd | ||||||
---|---|---|---|---|---|---|---|
Title | Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT) | ||||||
![]() |
| ||||||
![]() | DNA BINDING PROTEIN/DNA / Protein-DNA complex / HTH domain / DNA bending / indirect recognition / DNA BINDING PROTEIN-DNA complex | ||||||
Function / homology | ![]() invertasome / positive regulation of DNA recombination / sequence-specific DNA binding, bending / provirus excision / nucleoid / DNA-binding transcription repressor activity / DNA-binding transcription activator activity / chromosome organization / core promoter sequence-specific DNA binding / protein-DNA complex ...invertasome / positive regulation of DNA recombination / sequence-specific DNA binding, bending / provirus excision / nucleoid / DNA-binding transcription repressor activity / DNA-binding transcription activator activity / chromosome organization / core promoter sequence-specific DNA binding / protein-DNA complex / response to radiation / nucleosome / sequence-specific DNA binding / transcription cis-regulatory region binding / DNA-templated transcription / regulation of DNA-templated transcription / protein homodimerization activity / DNA binding / cytosol Similarity search - Function | ||||||
Biological species | ![]() ![]() synthetic construct (others) | ||||||
Method | ![]() ![]() ![]() ![]() | ||||||
![]() | Hancock, S.P. / Cascio, D. / Johnson, R.C. | ||||||
Funding support | ![]()
| ||||||
![]() | ![]() Title: DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Authors: Hancock, S.P. / Stella, S. / Cascio, D. / Johnson, R.C. | ||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 145.3 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 111.1 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Summary document | ![]() | 439.6 KB | Display | ![]() |
---|---|---|---|---|
Full document | ![]() | 439.5 KB | Display | |
Data in XML | ![]() | 9.7 KB | Display | |
Data in CIF | ![]() | 12.7 KB | Display | |
Arichive directory | ![]() ![]() | HTTPS FTP |
-Related structure data
Related structure data | ![]() 5ds9C ![]() 5e3lC ![]() 5e3mC ![]() 5e3nC ![]() 5e3oC ![]() 3iv5S S: Starting model for refinement C: citing same article ( |
---|---|
Similar structure data |
-
Links
-
Assembly
Deposited unit | ![]()
| ||||||||
---|---|---|---|---|---|---|---|---|---|
1 |
| ||||||||
Unit cell |
|
-
Components
#1: Protein | Mass: 11252.918 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() ![]() #2: DNA chain | | Mass: 8335.403 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others) #3: DNA chain | | Mass: 8251.388 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others) #4: Water | ChemComp-HOH / | |
---|
-Experimental details
-Experiment
Experiment | Method: ![]() |
---|
-
Sample preparation
Crystal | Density Matthews: 3.98 Å3/Da / Density % sol: 69.09 % |
---|---|
Crystal grow | Temperature: 277 K / Method: vapor diffusion, hanging drop / pH: 8.5 Details: 0.2 M Sodium citrate, 0.1 M TRIS-HCl pH 8.5, 36% PEG 400 |
-Data collection
Diffraction | Mean temperature: 100 K | |||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Diffraction source | Source: ![]() ![]() ![]() | |||||||||||||||||||||||||||
Detector | Type: ADSC QUANTUM 315 / Detector: CCD / Date: Mar 4, 2011 | |||||||||||||||||||||||||||
Radiation | Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray | |||||||||||||||||||||||||||
Radiation wavelength | Wavelength: 0.97949 Å / Relative weight: 1 | |||||||||||||||||||||||||||
Reflection | Resolution: 2.64→79.77 Å / Num. obs: 18446 / % possible obs: 96.5 % / Redundancy: 3.9 % / Biso Wilson estimate: 36.75 Å2 / CC1/2: 0.999 / Rmerge(I) obs: 0.049 / Rpim(I) all: 0.029 / Net I/σ(I): 17.2 / Num. measured all: 71833 / Scaling rejects: 1 | |||||||||||||||||||||||||||
Reflection shell | Diffraction-ID: 1 / Rejects: _
|
-Phasing
Phasing | Method: ![]() |
---|
-
Processing
Software |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Method to determine structure: ![]() Starting model: 3IV5 Resolution: 2.642→44.609 Å / SU ML: 0.34 / Cross valid method: FREE R-VALUE / σ(F): 1.34 / Phase error: 27.62 / Stereochemistry target values: ML
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Solvent computation | Shrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Displacement parameters | Biso max: 119.18 Å2 / Biso mean: 40.9643 Å2 / Biso min: 9.81 Å2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement step | Cycle: final / Resolution: 2.642→44.609 Å
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refine LS restraints |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
LS refinement shell | Refine-ID: X-RAY DIFFRACTION / Total num. of bins used: 12
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement TLS params. | Method: refined / Origin x: -11.1403 Å / Origin y: 1.8005 Å / Origin z: -5.5673 Å
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement TLS group |
|