[English] 日本語
Yorodumi
- PDB-5ds9: Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATT... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 5ds9
TitleCrystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)
Components
  • (DNA (27-MER)) x 2
  • DNA-binding protein Fis
KeywordsDNA BINDING PROTEIN/DNA / Protein-DNA complex / HTH domain / DNA bending / indirect recognition / DNA BINDING PROTEIN-DNA complex
Function / homology
Function and homology information


invertasome / positive regulation of DNA recombination / sequence-specific DNA binding, bending / provirus excision / nucleoid / DNA-binding transcription repressor activity / DNA-binding transcription activator activity / chromosome organization / core promoter sequence-specific DNA binding / protein-DNA complex ...invertasome / positive regulation of DNA recombination / sequence-specific DNA binding, bending / provirus excision / nucleoid / DNA-binding transcription repressor activity / DNA-binding transcription activator activity / chromosome organization / core promoter sequence-specific DNA binding / protein-DNA complex / response to radiation / nucleosome / sequence-specific DNA binding / transcription cis-regulatory region binding / regulation of DNA-templated transcription / DNA-templated transcription / protein homodimerization activity / DNA binding / cytosol
Similarity search - Function
DNA-binding protein Fis / : / DNA binding HTH domain, Fis-type / Bacterial regulatory protein, Fis family / Homeodomain-like / Homeobox-like domain superfamily / Arc Repressor Mutant, subunit A / Orthogonal Bundle / Mainly Alpha
Similarity search - Domain/homology
DNA / DNA (> 10) / DNA-binding protein Fis
Similarity search - Component
Biological speciesEscherichia coli (E. coli)
synthetic construct (others)
MethodX-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / molecular replacement / Resolution: 2.561 Å
AuthorsHancock, S.P. / Cascio, D. / Johnson, R.C.
CitationJournal: Plos One / Year: 2016
Title: DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Authors: Hancock, S.P. / Stella, S. / Cascio, D. / Johnson, R.C.
History
DepositionSep 17, 2015Deposition site: RCSB / Processing site: RCSB
Revision 1.0Jul 27, 2016Provider: repository / Type: Initial release
Revision 1.1Sep 27, 2023Group: Data collection / Database references ...Data collection / Database references / Derived calculations / Refinement description
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / database_2 / diffrn_radiation_wavelength / pdbx_initial_refinement_model / pdbx_prerelease_seq / pdbx_struct_oper_list
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession / _pdbx_struct_oper_list.symmetry_operation

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: DNA-binding protein Fis
B: DNA-binding protein Fis
C: DNA (27-MER)
D: DNA (27-MER)


Theoretical massNumber of molelcules
Total (without water)39,0914
Polymers39,0914
Non-polymers00
Water724
1


  • Idetical with deposited unit
  • defined by author&software
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area8800 Å2
ΔGint-61 kcal/mol
Surface area18940 Å2
MethodPISA
Unit cell
Length a, b, c (Å)43.290, 93.950, 154.510
Angle α, β, γ (deg.)90.000, 90.000, 90.000
Int Tables number19
Space group name H-MP212121

-
Components

#1: Protein DNA-binding protein Fis / Factor-for-inversion stimulation protein / Hin recombinational enhancer-binding protein


Mass: 11252.918 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (strain K12) (bacteria)
Strain: K12 / Gene: fis, b3261, JW3229 / Plasmid: pET11a / Production host: Escherichia coli (E. coli) / Strain (production host): BL21(DE3) / References: UniProt: P0A6R3
#2: DNA chain DNA (27-MER)


Mass: 8334.415 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)
#3: DNA chain DNA (27-MER)


Mass: 8250.399 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)
#4: Water ChemComp-HOH / water


Mass: 18.015 Da / Num. of mol.: 4 / Source method: isolated from a natural source / Formula: H2O

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 1

-
Sample preparation

CrystalDensity Matthews: 4.02 Å3/Da / Density % sol: 69.39 %
Crystal growTemperature: 277 K / Method: vapor diffusion, hanging drop / pH: 8.5
Details: 0.2 M Sodium citrate, 0.1 M TRIS-HCl pH 8.5, 36% PEG 400

-
Data collection

DiffractionMean temperature: 100 K
Diffraction sourceSource: SYNCHROTRON / Site: APS / Beamline: 24-ID-C / Wavelength: 0.97949 Å
DetectorType: ADSC QUANTUM 315 / Detector: CCD / Date: Oct 17, 2010
RadiationProtocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 0.97949 Å / Relative weight: 1
ReflectionResolution: 2.56→154.51 Å / Num. obs: 19332 / % possible obs: 91.6 % / Redundancy: 5.8 % / Biso Wilson estimate: 38.59 Å2 / CC1/2: 0.998 / Rmerge(I) obs: 0.067 / Rpim(I) all: 0.03 / Net I/σ(I): 14.7 / Num. measured all: 112418 / Scaling rejects: 107
Reflection shell

Diffraction-ID: 1 / Rejects: _

Resolution (Å)Redundancy (%)Rmerge(I) obsMean I/σ(I) obsNum. measured allNum. unique allCC1/2Rpim(I) all% possible all
2.56-2.73.70.692.2705819030.7850.39763.5
8.1-154.515.10.04529.836817150.9980.02192.5

-
Phasing

PhasingMethod: molecular replacement

-
Processing

Software
NameVersionClassification
PHENIXrefinement
Aimless0.5.14data scaling
PHASER2.5.2phasing
PDB_EXTRACT3.15data extraction
XDSdata reduction
RefinementMethod to determine structure: MOLECULAR REPLACEMENT
Starting model: 3IV5
Resolution: 2.561→45.162 Å / SU ML: 0.28 / Cross valid method: FREE R-VALUE / σ(F): 1.34 / Phase error: 26.44 / Stereochemistry target values: ML
RfactorNum. reflection% reflection
Rfree0.2514 937 4.93 %
Rwork0.2229 18083 -
obs0.2243 19020 90.27 %
Solvent computationShrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL
Displacement parametersBiso max: 177 Å2 / Biso mean: 57.283 Å2 / Biso min: 15.71 Å2
Refinement stepCycle: final / Resolution: 2.561→45.162 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms1505 1101 0 4 2610
Biso mean---32.23 -
Num. residues----243
Refine LS restraints
Refine-IDTypeDev idealNumber
X-RAY DIFFRACTIONf_bond_d0.0172766
X-RAY DIFFRACTIONf_angle_d1.0433942
X-RAY DIFFRACTIONf_chiral_restr0.042450
X-RAY DIFFRACTIONf_plane_restr0.005320
X-RAY DIFFRACTIONf_dihedral_angle_d26.5761128
LS refinement shell

Refine-ID: X-RAY DIFFRACTION / Total num. of bins used: 7

Resolution (Å)Rfactor RfreeNum. reflection RfreeRfactor RworkNum. reflection RworkNum. reflection all% reflection obs (%)
2.5609-2.69590.2922850.27371520160554
2.6959-2.86480.33071290.29228242953100
2.8648-3.08590.2971470.281828112958100
3.0859-3.39640.30541480.250428032951100
3.3964-3.88760.21191230.21242401252486
3.8876-4.89710.22041480.18082769291798
4.8971-45.16930.22551570.1962955311297
Refinement TLS params.Method: refined / Origin x: -11.2333 Å / Origin y: 2.0456 Å / Origin z: -5.5791 Å
111213212223313233
T0.3873 Å2-0.0642 Å2-0.0081 Å2-0.3692 Å20.0126 Å2--0.3108 Å2
L1.6502 °20.0185 °20.5555 °2-1.3064 °2-0.051 °2--2.4047 °2
S0.025 Å °0.1575 Å °-0.3787 Å °-0.2514 Å °0.2225 Å °0.0132 Å °0.9357 Å °-0.1394 Å °-0.1957 Å °
Refinement TLS group
IDRefine-IDRefine TLS-IDSelection detailsAuth asym-IDAuth seq-ID
1X-RAY DIFFRACTION1allA8 - 98
2X-RAY DIFFRACTION1allB1 - 98
3X-RAY DIFFRACTION1allC1 - 27
4X-RAY DIFFRACTION1allD1 - 27
5X-RAY DIFFRACTION1allE1 - 4

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more