[English] 日本語

- PDB-5ds9: Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATT... -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 5ds9 | ||||||
---|---|---|---|---|---|---|---|
Title | Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT) | ||||||
![]() |
| ||||||
![]() | DNA BINDING PROTEIN/DNA / Protein-DNA complex / HTH domain / DNA bending / indirect recognition / DNA BINDING PROTEIN-DNA complex | ||||||
Function / homology | ![]() invertasome / positive regulation of DNA recombination / sequence-specific DNA binding, bending / provirus excision / nucleoid / DNA-binding transcription repressor activity / DNA-binding transcription activator activity / chromosome organization / core promoter sequence-specific DNA binding / response to radiation ...invertasome / positive regulation of DNA recombination / sequence-specific DNA binding, bending / provirus excision / nucleoid / DNA-binding transcription repressor activity / DNA-binding transcription activator activity / chromosome organization / core promoter sequence-specific DNA binding / response to radiation / protein-DNA complex / nucleosome / sequence-specific DNA binding / transcription cis-regulatory region binding / DNA-templated transcription / regulation of DNA-templated transcription / protein homodimerization activity / DNA binding / cytosol Similarity search - Function | ||||||
Biological species | ![]() ![]() synthetic construct (others) | ||||||
Method | ![]() ![]() ![]() ![]() | ||||||
![]() | Hancock, S.P. / Cascio, D. / Johnson, R.C. | ||||||
![]() | ![]() Title: DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Authors: Hancock, S.P. / Stella, S. / Cascio, D. / Johnson, R.C. | ||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 146.7 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 112.8 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Summary document | ![]() | 439.7 KB | Display | ![]() |
---|---|---|---|---|
Full document | ![]() | 440.4 KB | Display | |
Data in XML | ![]() | 9.8 KB | Display | |
Data in CIF | ![]() | 12.9 KB | Display | |
Arichive directory | ![]() ![]() | HTTPS FTP |
-Related structure data
Related structure data | ![]() 5dtdC ![]() 5e3lC ![]() 5e3mC ![]() 5e3nC ![]() 5e3oC ![]() 3iv5S C: citing same article ( S: Starting model for refinement |
---|---|
Similar structure data |
-
Links
-
Assembly
Deposited unit | ![]()
| ||||||||
---|---|---|---|---|---|---|---|---|---|
1 |
| ||||||||
Unit cell |
|
-
Components
#1: Protein | Mass: 11252.918 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() Strain: K12 / Gene: fis, b3261, JW3229 / Plasmid: pET11a / Production host: ![]() ![]() #2: DNA chain | | Mass: 8334.415 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others) #3: DNA chain | | Mass: 8250.399 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others) #4: Water | ChemComp-HOH / | |
---|
-Experimental details
-Experiment
Experiment | Method: ![]() |
---|
-
Sample preparation
Crystal | Density Matthews: 4.02 Å3/Da / Density % sol: 69.39 % |
---|---|
Crystal grow | Temperature: 277 K / Method: vapor diffusion, hanging drop / pH: 8.5 Details: 0.2 M Sodium citrate, 0.1 M TRIS-HCl pH 8.5, 36% PEG 400 |
-Data collection
Diffraction | Mean temperature: 100 K | |||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Diffraction source | Source: ![]() ![]() ![]() | |||||||||||||||||||||||||||
Detector | Type: ADSC QUANTUM 315 / Detector: CCD / Date: Oct 17, 2010 | |||||||||||||||||||||||||||
Radiation | Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray | |||||||||||||||||||||||||||
Radiation wavelength | Wavelength: 0.97949 Å / Relative weight: 1 | |||||||||||||||||||||||||||
Reflection | Resolution: 2.56→154.51 Å / Num. obs: 19332 / % possible obs: 91.6 % / Redundancy: 5.8 % / Biso Wilson estimate: 38.59 Å2 / CC1/2: 0.998 / Rmerge(I) obs: 0.067 / Rpim(I) all: 0.03 / Net I/σ(I): 14.7 / Num. measured all: 112418 / Scaling rejects: 107 | |||||||||||||||||||||||||||
Reflection shell | Diffraction-ID: 1 / Rejects: _
|
-Phasing
Phasing | Method: ![]() |
---|
-
Processing
Software |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Method to determine structure: ![]() Starting model: 3IV5 Resolution: 2.561→45.162 Å / SU ML: 0.28 / Cross valid method: FREE R-VALUE / σ(F): 1.34 / Phase error: 26.44 / Stereochemistry target values: ML
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Solvent computation | Shrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Displacement parameters | Biso max: 177 Å2 / Biso mean: 57.283 Å2 / Biso min: 15.71 Å2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement step | Cycle: final / Resolution: 2.561→45.162 Å
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refine LS restraints |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
LS refinement shell | Refine-ID: X-RAY DIFFRACTION / Total num. of bins used: 7
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement TLS params. | Method: refined / Origin x: -11.2333 Å / Origin y: 2.0456 Å / Origin z: -5.5791 Å
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement TLS group |
|