[English] 日本語

- PDB-4ihv: Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTG... -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 4ihv | ||||||
---|---|---|---|---|---|---|---|
Title | Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT) | ||||||
![]() |
| ||||||
![]() | TRANSCRIPTION/DNA / Protein-DNA complex / HTH domain / minor groove compression / DNA bending / indirect recognition / TRANSCRIPTION-DNA complex | ||||||
Function / homology | Homeodomain-like / Arc Repressor Mutant, subunit A / Orthogonal Bundle / Mainly Alpha / DNA / DNA (> 10) / : ![]() | ||||||
Biological species | ![]() ![]() | ||||||
Method | ![]() ![]() ![]() ![]() | ||||||
![]() | Hancock, S.P. / Cascio, D. / Johnson, R.C. | ||||||
![]() | ![]() Title: Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Authors: Hancock, S.P. / Ghane, T. / Cascio, D. / Rohs, R. / Di Felice, R. / Johnson, R.C. | ||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 81.5 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 57.5 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Arichive directory | ![]() ![]() | HTTPS FTP |
---|
-Related structure data
Related structure data | ![]() 4ihwC ![]() 4ihxC ![]() 4ihyC ![]() 3iv5S C: citing same article ( S: Starting model for refinement |
---|---|
Similar structure data |
-
Links
-
Assembly
Deposited unit | ![]()
| ||||||||
---|---|---|---|---|---|---|---|---|---|
1 |
| ||||||||
Unit cell |
|
-
Components
#1: Protein | Mass: 11252.918 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() ![]() #2: DNA chain | | Mass: 8360.416 Da / Num. of mol.: 1 / Source method: obtained synthetically #3: DNA chain | | Mass: 8227.362 Da / Num. of mol.: 1 / Source method: obtained synthetically #4: Water | ChemComp-HOH / | |
---|
-Experimental details
-Experiment
Experiment | Method: ![]() |
---|
-
Sample preparation
Crystal | Density Matthews: 3.77 Å3/Da / Density % sol: 67.38 % |
---|---|
Crystal grow | Temperature: 277 K / Method: vapor diffusion, hanging drop / pH: 8.5 Details: 0.2 M sodium citrate, 0.1 M Tris-HCl, pH 8.5, 36% PEG400, VAPOR DIFFUSION, HANGING DROP, temperature 277K |
-Data collection
Diffraction | Mean temperature: 100 K | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Diffraction source | Source: ![]() ![]() ![]() | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Detector | Type: ADSC QUANTUM 315 / Detector: CCD / Date: Jul 24, 2011 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Radiation | Monochromator: double crystal Si(111) / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Radiation wavelength | Wavelength: 0.92017 Å / Relative weight: 1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Reflection | Resolution: 2.716→100 Å / Num. obs: 16603 / % possible obs: 99.6 % / Observed criterion σ(I): -3 / Redundancy: 6.99 % / Biso Wilson estimate: 63.279 Å2 / Rmerge(I) obs: 0.082 / Net I/σ(I): 16.06 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Reflection shell | Diffraction-ID: 1
|
-Phasing
Phasing | Method: ![]() | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Phasing MR | Model details: Phaser MODE: MR_AUTO
|
-
Processing
Software |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Method to determine structure: ![]() Starting model: PDB ENTRY 3IV5 Resolution: 2.716→42.927 Å / Occupancy max: 1 / Occupancy min: 1 / FOM work R set: 0.7835 / SU ML: 0.37 / Cross valid method: THROUGHOUT / σ(F): 2 / Phase error: 27.5 / Stereochemistry target values: ML
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Solvent computation | Shrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Displacement parameters | Biso max: 105.7 Å2 / Biso mean: 38.3474 Å2 / Biso min: 8.42 Å2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement step | Cycle: LAST / Resolution: 2.716→42.927 Å
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refine LS restraints |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
LS refinement shell | Refine-ID: X-RAY DIFFRACTION / Total num. of bins used: 12
|