1JBD
 
 | | NMR Structure of the Complex Between alpha-bungarotoxin and a Mimotope of the Nicotinic Acetylcholine Receptor | | Descriptor: | LONG NEUROTOXIN 1, MIMOTOPE OF THE NICOTINIC ACETYLCHOLINE RECEPTOR | | Authors: | Scarselli, M, Spiga, O, Ciutti, A, Bracci, L, Lelli, B, Lozzi, L, Calamandrei, D, Bernini, A, Di Maro, D, Klein, S, Niccolai, N. | | Deposit date: | 2001-06-04 | | Release date: | 2001-06-27 | | Last modified: | 2022-02-23 | | Method: | SOLUTION NMR | | Cite: | NMR structure of alpha-bungarotoxin free and bound to a mimotope of the nicotinic acetylcholine receptor.
Biochemistry, 41, 2002
|
|
1R7Z
 | | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1R7W
 | | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1TOF
 | | THIOREDOXIN H (OXIDIZED FORM), NMR, 23 STRUCTURES | | Descriptor: | THIOREDOXIN H | | Authors: | Mittard, V, Blackledge, M.J, Stein, M, Jacquot, J.-P, Marion, D, Lancelin, J.-M. | | Deposit date: | 1996-05-30 | | Release date: | 1996-12-07 | | Last modified: | 2022-03-02 | | Method: | SOLUTION NMR | | Cite: | NMR solution structure of an oxidised thioredoxin h from the eukaryotic green alga Chlamydomonas reinhardtii.
Eur.J.Biochem., 243, 1997
|
|
1TH5
 | | Solution structure of C-terminal domain of NifU-like protein from Oryza sativa | | Descriptor: | NifU1 | | Authors: | Kumeta, H, Ogura, K, Asayama, M, Katoh, S, Katoh, E, Inagaki, F. | | Deposit date: | 2004-06-01 | | Release date: | 2005-09-27 | | Last modified: | 2024-05-29 | | Method: | SOLUTION NMR | | Cite: | The NMR structure of the domain II of a chloroplastic NifU-like protein OsNifU1A.
J.Biomol.Nmr, 38, 2007
|
|
1IK8
 | | NMR structure of Alpha-Bungarotoxin | | Descriptor: | LONG NEUROTOXIN 1 | | Authors: | Niccolai, N, Ciutti, A, Spiga, O. | | Deposit date: | 2001-05-03 | | Release date: | 2001-05-16 | | Last modified: | 2022-02-23 | | Method: | SOLUTION NMR | | Cite: | NMR structure of alpha-bungarotoxin free and bound to a mimotope of the nicotinic acetylcholine receptor.
Biochemistry, 41, 2002
|
|
1DBY
 | | NMR STRUCTURES OF CHLOROPLAST THIOREDOXIN M CH2 FROM THE GREEN ALGA CHLAMYDOMONAS REINHARDTII | | Descriptor: | CHLOROPLAST THIOREDOXIN M CH2 | | Authors: | Lancelin, J.-M, Guilhaudis, L, Krimm, I, Blackledge, M.J, Marion, D. | | Deposit date: | 1999-11-03 | | Release date: | 1999-11-08 | | Last modified: | 2022-02-16 | | Method: | SOLUTION NMR | | Cite: | NMR structures of thioredoxin m from the green alga Chlamydomonas reinhardtii.
Proteins, 41, 2000
|
|
1RY3
 | | NMR Solution Structure of the Precursor for Carnobacteriocin B2, an Antimicrobial Peptide from Carnobacterium piscicola | | Descriptor: | Bacteriocin carnobacteriocin B2 | | Authors: | Sprules, T, Kawulka, K.E, Gibbs, A.C, Wishart, D.S, Vederas, J.C. | | Deposit date: | 2003-12-19 | | Release date: | 2004-05-04 | | Last modified: | 2022-03-02 | | Method: | SOLUTION NMR | | Cite: | NMR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide from Carnobacterium piscicola.
Eur.J.Biochem., 271, 2004
|
|
1TRL
 | | NMR SOLUTION STRUCTURE OF THE C-TERMINAL FRAGMENT 255-316 OF THERMOLYSIN: A DIMER FORMED BY SUBUNITS HAVING THE NATIVE STRUCTURE | | Descriptor: | THERMOLYSIN FRAGMENT 255 - 316 | | Authors: | Rico, M, Jimenez, M.A, Gonzalez, C, De Filippis, V, Fontana, A. | | Deposit date: | 1994-09-02 | | Release date: | 1995-02-07 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR solution structure of the C-terminal fragment 255-316 of thermolysin: a dimer formed by subunits having the native structure.
Biochemistry, 33, 1994
|
|
1Q5F
 | | NMR Structure of Type IVb pilin (PilS) from Salmonella typhi | | Descriptor: | PilS | | Authors: | Xu, X.F, Tan, Y.W, Hackett, J, Zhang, M, Mok, Y.K. | | Deposit date: | 2003-08-07 | | Release date: | 2004-07-27 | | Last modified: | 2022-03-02 | | Method: | SOLUTION NMR | | Cite: | NMR Structure of a Type IVb Pilin from Salmonella typhi and Its Assembly into Pilus
J.Biol.Chem., 279, 2004
|
|
1RGJ
 | | NMR STRUCTURE OF THE COMPLEX BETWEEN ALPHA-BUNGAROTOXIN AND MIMOTOPE OF THE NICOTINIC ACETYLCHOLINE RECEPTOR WITH ENHANCED ACTIVITY | | Descriptor: | MIMOTOPE OF THE NICOTINIC ACETYLCHOLINE RECEPTOR, long neurotoxin 1 | | Authors: | Bernini, A, Spiga, O, Ciutti, A, Scarselli, M, Bracci, L, Lozzi, L, Lelli, B, Neri, P, Niccolai, N. | | Deposit date: | 2003-11-12 | | Release date: | 2003-11-25 | | Last modified: | 2022-03-02 | | Method: | SOLUTION NMR | | Cite: | NMR and MD studies on the interaction between ligand peptides and alpha-bungarotoxin.
J.Mol.Biol., 339, 2004
|
|
1P6S
 | | Solution Structure of the Pleckstrin Homology Domain of Human Protein Kinase B beta (Pkb/Akt) | | Descriptor: | RAC-beta serine/threonine protein kinase | | Authors: | Auguin, D, Barthe, P, Auge-Senegas, M.T, Stern, M.H, Noguchi, M, Roumestand, C. | | Deposit date: | 2003-04-30 | | Release date: | 2004-05-18 | | Last modified: | 2022-02-23 | | Method: | SOLUTION NMR | | Cite: | Solution structure and backbone dynamics of the pleckstrin homology domain of the human
protein kinase B (PKB/Akt). Interaction with inositol phosphates.
J.BIOMOL.NMR, 28, 2004
|
|
1HOY
 | | NMR STRUCTURE OF THE COMPLEX BETWEEN A-BUNGAROTOXIN AND A MIMOTOPE OF THE NICOTINIC ACETYLCHOLINE RECEPTOR | | Descriptor: | LONG NEUROTOXIN 1, MIMOTOPE OF THE NICOTINIC ACETYLCHOLINE RECEPTOR | | Authors: | Scarselli, M, Spiga, O, Ciutti, A, Bracci, L, Lelli, B, Lozzi, L, Calamandrei, D, Bernini, A, Di Maro, D, Niccolai, N, Neri, P. | | Deposit date: | 2000-12-12 | | Release date: | 2000-12-27 | | Last modified: | 2022-02-23 | | Method: | SOLUTION NMR | | Cite: | NMR structure of alpha-bungarotoxin free and bound to a mimotope of the nicotinic acetylcholine receptor.
Biochemistry, 41, 2002
|
|
1OKD
 | | NMR-structure of tryparedoxin 1 | | Descriptor: | TRYPAREDOXIN 1 | | Authors: | Krumme, D, Budde, H, Hecht, H.-J, Menge, U, Ohlenschlager, O, Ross, A, Wissing, J, Wray, V, Flohe, L. | | Deposit date: | 2003-07-22 | | Release date: | 2003-08-28 | | Last modified: | 2018-01-17 | | Method: | SOLUTION NMR | | Cite: | NMR studies of the interaction of tryparedoxin with redox-inactive substrate homologues.
Biochemistry, 42, 2003
|
|
1IKC
 | | NMR Structure of alpha-Bungarotoxin | | Descriptor: | long neurotoxin 1 | | Authors: | Niccolai, N, Spiga, O, Ciutti, A. | | Deposit date: | 2001-05-03 | | Release date: | 2001-05-16 | | Last modified: | 2022-02-23 | | Method: | SOLUTION NMR | | Cite: | NMR structure of alpha-bungarotoxin free and bound to a mimotope of the nicotinic acetylcholine receptor.
Biochemistry, 41, 2002
|
|
1TDP
 | |
1NYA
 | | NMR SOLUTION STRUCTURE OF CALERYTHRIN, AN EF-HAND CALCIUM-BINDING PROTEIN | | Descriptor: | CALCIUM ION, Calerythrin | | Authors: | Tossavainen, H, Permi, P, Annila, A, Kilpelainen, I, Drakenberg, T. | | Deposit date: | 2003-02-12 | | Release date: | 2003-08-05 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR solution structure of calerythrin, an EF-hand calcium-binding protein from Saccharopolyspora erythraea
Eur.J.Biochem., 270, 2003
|
|
1OW9
 | | NMR Structure of the Active Conformation of the VS Ribozyme Cleavage Site | | Descriptor: | A mimic of the VS Ribozyme Hairpin Substrate | | Authors: | Hoffmann, B, Mitchell, G.T, Gendron, P, Major, F, Andersen, A.A, Collins, R.A, Legault, P. | | Deposit date: | 2003-03-28 | | Release date: | 2003-05-20 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structure of the Active Conformation of the Varkud satellite Ribozyme Cleavage Site
Proc.Natl.Acad.Sci.USA, 100, 2003
|
|
1F6U
 | | NMR structure of the HIV-1 nucleocapsid protein bound to stem-loop sl2 of the psi-RNA packaging signal. Implications for genome recognition | | Descriptor: | HIV-1 NUCLEOCAPSID PROTEIN, HIV-1 STEM-LOOP SL2 FROM PSI-RNA PACKAGING, ZINC ION | | Authors: | Amarasinghe, G.K, De Guzman, R.N, Turner, R.B, Chancellor, K.J, Summers, M.F. | | Deposit date: | 2000-06-23 | | Release date: | 2000-10-09 | | Last modified: | 2022-02-16 | | Method: | SOLUTION NMR | | Cite: | NMR structure of the HIV-1 nucleocapsid protein bound to stem-loop SL2 of the psi-RNA packaging signal. Implications for genome recognition.
J.Mol.Biol., 301, 2000
|
|
1GNF
 | | SOLUTION STRUCTURE OF THE N-TERMINAL ZINC FINGER OF MURINE GATA-1, NMR, 25 STRUCTURES | | Descriptor: | TRANSCRIPTION FACTOR GATA-1, ZINC ION | | Authors: | Kowalski, K, Czolij, R, King, G.F, Crossley, M, Mackay, J.P. | | Deposit date: | 1998-10-12 | | Release date: | 1999-06-08 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | The solution structure of the N-terminal zinc finger of GATA-1 reveals a specific binding face for the transcriptional co-factor FOG.
J.Biomol.NMR, 13, 1999
|
|
1I5J
 | |
1L3G
 | | NMR Structure of the DNA-binding Domain of Cell Cycle Protein, Mbp1(2-124) from Saccharomyces cerevisiae | | Descriptor: | TRANSCRIPTION FACTOR Mbp1 | | Authors: | Nair, M, McIntosh, P.B, Frenkiel, T.A, Kelly, G, Taylor, I.A, Smerdon, S.J, Lane, A.N. | | Deposit date: | 2002-02-27 | | Release date: | 2003-02-18 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structure of the DNA-Binding Domain of the Cell Cycle Protein Mbp1 from Saccharomyces cerevisiae
Biochemistry, 42, 2003
|
|
1ESY
 | |
1MQX
 | | NMR Solution Structure of Type-B Lantibiotics Mersacidin in MeOH/H2O Mixture | | Descriptor: | LANTIBIOTIC MERSACIDIN | | Authors: | Hsu, S.-T, Breukink, E, Bierbaum, G, Sahl, H.-G, de Kruijff, B, Kaptein, R, van Nuland, N.A, Bonvin, A.M. | | Deposit date: | 2002-09-17 | | Release date: | 2003-03-11 | | Last modified: | 2024-07-10 | | Method: | SOLUTION NMR | | Cite: | NMR Study of Mersacidin and Lipid II Interaction in Dodecylphosphocholine Micelles. Conformational Changes are a Key to Antimicrobial Activity
J.Biol.Chem., 278, 2003
|
|
1MQZ
 | | NMR solution structure of type-B lantibiotics mersacidin bound to lipid II in DPC micelles | | Descriptor: | LANTIBIOTIC MERSACIDIN | | Authors: | Hsu, S.-T, Breukink, E, Bierbaum, G, Sahl, H.-G, de Kruijff, B, Kaptein, R, van Nuland, N.A, Bonvin, A.M. | | Deposit date: | 2002-09-17 | | Release date: | 2003-03-11 | | Last modified: | 2024-07-10 | | Method: | SOLUTION NMR | | Cite: | NMR Study of Mersacidin and Lipid II Interaction in Dodecylphosphocholine Micelles. Conformational Changes are a Key to Antimicrobial Activity
J.Biol.Chem., 278, 2003
|
|
