PDB: 45953 resultsInfo pagesStatus searchChemie searchBIRD

---

5J4P	DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTTGG) in sodium Descriptor: DNA (5'-D(*GP*GP*TP*TP*TP*GP*GP*TP*TP*TP*TP*GP*GP*TP*TP*TP*GP*G)-3') Authors: Dvorkin, S.A, Webba da Silva, M. Deposit date: 2016-04-01 Release date: 2017-06-14 Last modified: 2024-06-19 Method: SOLUTION NMR Cite: Encoding canonical DNA quadruplex structure. Sci Adv, 4, 2018
1NJG	Nucleotide-free form of an Isolated E. coli Clamp Loader Gamma Subunit Descriptor: DNA polymerase III subunit gamma, SULFATE ION, ZINC ION Authors: Podobnik, M, Weitze, T.F, O'Donnell, M, Kuriyan, J. Deposit date: 2002-12-30 Release date: 2003-04-01 Last modified: 2023-08-16 Method: X-RAY DIFFRACTION (2.2 Å) Cite: Nucleotide-Induced Conformational Changes in an Isolated Escherichia coli DNA Polymerase III Clamp Loader Subunit Structure, 11, 2003
4ROG	Sequence and structure of a self-assembled 3-D DNA crystal: D(GGACACGTGGGAG) Descriptor: D(GGACACGTGGGAG), MAGNESIUM ION Authors: Saoji, M.M, Paukstelis, P.J. Deposit date: 2014-10-28 Release date: 2015-06-17 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.08 Å) Cite: Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers, 103, 2015
4ROK	Sequence and structure of a self-assembled 3-D DNA crystal: D(GGACAGCTGGGAG) Descriptor: D(GGACAGCTGGGAG), MAGNESIUM ION Authors: Saoji, M.M, Paukstelis, P.J. Deposit date: 2014-10-28 Release date: 2015-06-17 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.16 Å) Cite: Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers, 103, 2015
4RON	Sequence and structure of a self-assembled 3-D DNA crystal: D(GGACCATGGGGAG) Descriptor: D(GGACCATGGGGAG), MAGNESIUM ION Authors: Saoji, M.M, Paukstelis, P.J. Deposit date: 2014-10-28 Release date: 2015-06-17 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.39 Å) Cite: Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers, 103, 2015
4RP2	Sequence and structure of a self-assembled 3-D DNA crystal: D(GGATAGCTAGGAG) Descriptor: D(GGATAGCTAGGAG), MAGNESIUM ION Authors: Saoji, M.M, Paukstelis, P.J. Deposit date: 2014-10-29 Release date: 2015-06-17 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.32 Å) Cite: Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers, 103, 2015
4ROY	Sequence and structure of a self-assembled 3-D DNA crystal: D(GGACGATCGGGAG) Descriptor: D(GGACGATCGGGAG), MAGNESIUM ION Authors: Saoji, M.M, Paukstelis, P.J. Deposit date: 2014-10-29 Release date: 2015-06-17 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.09 Å) Cite: Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers, 103, 2015
4RP0	Sequence and structure of a self-assembled 3-D DNA crystal: D(GGATAATTAGGAG) Descriptor: D(GGATAATTAGGAG), MAGNESIUM ION Authors: Saoji, M.M, Paukstelis, P.J. Deposit date: 2014-10-29 Release date: 2015-06-17 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.19 Å) Cite: Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers, 103, 2015
4ROO	Sequence and structure of a self-assembled 3-D DNA crystal: D(GGACCGCGGGGAG) Descriptor: D(GGACCGCGGGGAG), MAGNESIUM ION Authors: Saoji, M.M, Paukstelis, P.J. Deposit date: 2014-10-28 Release date: 2015-06-17 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.37 Å) Cite: Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers, 103, 2015
4ROZ	Sequence and structure of a self-assembled 3-D DNA crystal: D(GGACGGCCGGGAG) Descriptor: D(GGACGGCCGGGAG), MAGNESIUM ION Authors: Saoji, M.M, Paukstelis, P.J. Deposit date: 2014-10-29 Release date: 2015-06-17 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.08 Å) Cite: Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers, 103, 2015
1CZD	CRYSTAL STRUCTURE OF THE PROCESSIVITY CLAMP GP45 FROM BACTERIOPHAGE T4 Descriptor: DNA POLYMERASE ACCESSORY PROTEIN G45 Authors: Moarefi, I, Jeruzalmi, D, Turner, J, O'Donnell, M, Kuriyan, J. Deposit date: 1999-09-02 Release date: 2000-03-03 Last modified: 2024-02-07 Method: X-RAY DIFFRACTION (2.45 Å) Cite: Crystal structure of the DNA polymerase processivity factor of T4 bacteriophage. J.Mol.Biol., 296, 2000
5CHI	Crystal structure of PF2046 in complex with ssDNA Descriptor: DNA (5'-D(P*TP*TP*TP*T)-3'), MAGNESIUM ION, Uncharacterized protein Authors: Kim, J.S, Hwang, K.Y, Lee, W.C. Deposit date: 2015-07-10 Release date: 2016-08-10 Last modified: 2023-11-08 Method: X-RAY DIFFRACTION (2.472 Å) Cite: Structural basis of two-nucleotide removal of ssDNA by a cryptic RNase H fold 3'-5' exonuclease PF2046 from Pyrococcus furiosus to be published
4RNK	Sequence and structure of a self-assembled 3-D DNA crystal: D(GGAAAATTTGGAG) Descriptor: GGAAAATTTGGAG, MAGNESIUM ION Authors: Saoji, M.M, Paukstelis, P.J. Deposit date: 2014-10-24 Release date: 2015-06-17 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.08 Å) Cite: Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers, 103, 2015
4RO7	Sequence and structure of a self-assembled 3-D DNA crystal: D(GGAAAGCTTGGAG) Descriptor: D(GGAAAGCTTGGAG), MAGNESIUM ION Authors: Saoji, M.M, Paukstelis, P.J. Deposit date: 2014-10-28 Release date: 2015-06-17 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.03 Å) Cite: Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers, 103, 2015
4RO4	Sequence and structure of a self-assembled 3-D DNA crystal: D(GGAAACGTTGGAG) Descriptor: D(GGAAACGTTGGAG), MAGNESIUM ION Authors: Saoji, M.M, Paukstelis, P.J. Deposit date: 2014-10-27 Release date: 2015-06-17 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.04 Å) Cite: Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers, 103, 2015
4RP1	Sequence and structure of a self-assembled 3-D DNA crystal: D(GGATACGTAGGAG) Descriptor: D(GGATACGTAGGAG), MAGNESIUM ION Authors: Saoji, M.M, Paukstelis, P.J. Deposit date: 2014-10-29 Release date: 2015-06-17 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.27 Å) Cite: Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers, 103, 2015
4RO8	Sequence and structure of a self-assembled 3-D DNA crystal: D(GGAATCGATGGAG) Descriptor: D(GGAATCGATGGAG), MAGNESIUM ION Authors: Saoji, M.M, Paukstelis, P.J. Deposit date: 2014-10-28 Release date: 2015-06-17 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.08 Å) Cite: Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers, 103, 2015
6WQ0	Cryo-EM of the S. solfataricus rod-shaped virus, SSRV1 Descriptor: DNA (301-MER), Structural protein Authors: Wang, F, Baquero, D.P, Beltran, L.C, Prangishvili, D, Krupovic, M, Egelman, E.H. Deposit date: 2020-04-28 Release date: 2020-07-29 Last modified: 2024-05-29 Method: ELECTRON MICROSCOPY (2.8 Å) Cite: Structures of filamentous viruses infecting hyperthermophilic archaea explain DNA stabilization in extreme environments. Proc.Natl.Acad.Sci.USA, 117, 2020
1B60	3,N4-ETHENO-2'-DEOXYCYTIDINE OPPOSITE CYTIDINE IN AN 11-MER DUPLEX, SOLUTION STRUCTURE FROM NMR AND MOLECULAR DYNAMICS Descriptor: DNA (5'-D(*CP*GP*TP*AP*CP*(EDC)P*CP*AP*TP*GP*C)-3'), DNA (5'-D(*GP*CP*AP*TP*GP*CP*GP*TP*AP*CP*G)-3') Authors: Cullinan, D, Johnson, F, De Los Santos, C. Deposit date: 1999-01-20 Release date: 2000-02-18 Last modified: 2023-12-27 Method: SOLUTION NMR Cite: Solution structure of an 11-mer duplex containing the 3, N(4)-ethenocytosine adduct opposite 2'-deoxycytidine: implications for the recognition of exocyclic lesions by DNA glycosylases. J.Mol.Biol., 296, 2000
7EGT	The crystal structure of the C-terminal domain of T. thermophilus UvrD complexed with the N-terminal domain of UvrB Descriptor: DNA helicase UvrD, UvrABC system protein B Authors: Zheng, F, Shen, L, Li, L, Zhang, Y. Deposit date: 2021-03-26 Release date: 2022-04-06 Last modified: 2023-11-29 Method: X-RAY DIFFRACTION (2.581 Å) Cite: Crucial role and mechanism of transcription-coupled DNA repair in bacteria. Nature, 604, 2022
5J4W	DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium Descriptor: DNA (5'-D(*GP*GP*TP*TP*TP*GP*GP*TP*TP*TP*TP*GP*GP*TP*TP*GP*G)-3') Authors: Dvorkin, S.A, Webba da Silva, M. Deposit date: 2016-04-01 Release date: 2017-04-12 Last modified: 2024-06-19 Method: SOLUTION NMR Cite: Encoding canonical DNA quadruplex structure. Sci Adv, 4, 2018
5J6U	DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium Descriptor: DNA (25-MER) Authors: Dvorkin, S.A, Karsisiotis, A.I, Webba da Silva, M. Deposit date: 2016-04-05 Release date: 2017-05-10 Last modified: 2024-06-19 Method: SOLUTION NMR Cite: Encoding canonical DNA quadruplex structure. Sci Adv, 4, 2018
4QKK	Crystal structure of an oligonucleotide containing 5-formylcytosine Descriptor: DNA (5'-D(*CP*TP*AP*(5FC)P*GP*(5FC)P*GP*(5FC)P*GP*TP*AP*G)-3') Authors: Raiber, E.-A, Murat, P, Chirgadze, D.Y, Luisi, B.F, Balasubramanian, S. Deposit date: 2014-06-06 Release date: 2014-12-10 Last modified: 2024-03-20 Method: X-RAY DIFFRACTION (1.4 Å) Cite: 5-Formylcytosine alters the structure of the DNA double helix. Nat.Struct.Mol.Biol., 22, 2015
2QEF	X-ray structure of 7-deaza-dG and Z3dU modified duplex CGCGAATXCZCG Descriptor: DNA (5'-D(*DCP*DGP*DCP*DGP*DAP*DAP*DTP*(ZDU)P*DCP*(7GU)P*DCP*DG)-3') Authors: Wang, F, Li, F, Ganguly, M, Marky, L.A, Gold, B, Egli, M, Stone, M.P. Deposit date: 2007-06-25 Release date: 2008-05-06 Last modified: 2023-08-30 Method: X-RAY DIFFRACTION (1.6 Å) Cite: A bridging water anchors the tethered 5-(3-aminopropyl)-2'-deoxyuridine amine in the DNA major groove proximate to the N+2 C.G base pair: implications for formation of interstrand 5'-GNC-3' cross-links by nitrogen mustards. Biochemistry, 47, 2008
6JPI	Crystal structure of PA4674 in complex with its operator DNA (28bp) from Pseudomonas aeruginosa Descriptor: DNA (28-MER), HTH cro/C1-type domain-containing protein Authors: Liu, Y, Gao, Z, Zhang, H, Dong, Y. Deposit date: 2019-03-27 Release date: 2020-04-01 Last modified: 2023-11-22 Method: X-RAY DIFFRACTION (3.143 Å) Cite: Crystal structure of PA4674 in complex with its operator DNA (28bp) from Pseudomonas aeruginosa To Be Published

<241242243244245246247248249250251252253254255256>