PDB: 72308 resultsInfo pagesStatus searchChemie searchBIRD

---

2GUN	RNA-Binding Affinities and Crystal Structure of Oligonucleotides containing Five-Atom Amide-Based Backbone Structures Descriptor: 5'-D(*TP*TP*CP*(T2T)P*(CBR)P*TP*TP*C)-3', 5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*A)-3', COBALT (III) ION, ... Authors: Pallan, P.S, Egli, M. Deposit date: 2006-05-01 Release date: 2006-08-01 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (2.8 Å) Cite: RNA-Binding Affinities and Crystal Structure of Oligonucleotides Containing Five-Atom Amide-Based Backbone Structures. Biochemistry, 45, 2006
2V6W	tRNASer acceptor stem: Conformation and hydration of a microhelix in a crystal structure at 1.8 Angstrom resolution Descriptor: 5'-R(*GP*GP*AP*GP*AP*GP*AP)-3', 5'-R(*UP*CP*UP*CP*UP*CP*CP)-3' Authors: Foerster, C, Brauer, A.B.E, Brode, S, Fuerste, J.P, Betzel, C, Erdmann, V.A. Deposit date: 2007-07-23 Release date: 2007-11-06 Last modified: 2024-05-08 Method: X-RAY DIFFRACTION (1.8 Å) Cite: Trnaser Acceptor Stem: Conformation and Hydration of a Microhelix in a Crystal Structure at 1.8 A Resolution. Acta Crystallogr.,Sect.D, 63, 2007
3GVN	The 1.2 Angstroem crystal structure of an E.coli tRNASer acceptor stem microhelix reveals two magnesium binding sites Descriptor: 5'-R(*CP*CP*UP*CP*AP*CP*C)-3', 5'-R(*GP*GP*UP*GP*AP*GP*G)-3', MAGNESIUM ION Authors: Eichert, A, Furste, J.P, Schreiber, A, Perbandt, M, Betzel, C, Erdmann, V.A, Forster, C. Deposit date: 2009-03-31 Release date: 2009-07-28 Last modified: 2023-11-01 Method: X-RAY DIFFRACTION (1.2 Å) Cite: The 1.2A crystal structure of an E. coli tRNASer)acceptor stem microhelix reveals two magnesium binding sites. Biochem.Biophys.Res.Commun., 386, 2009
1TLR	SOLUTION STRUCTURE OF TETRALOOP RECEPTOR RNA, NMR, 20 STRUCTURES Descriptor: RNA TETRALOOP RECEPTOR (5'-R(GGCCUAAGACUUCGGUUAUGGCC)-3') Authors: Butcher, S.E, Dieckmann, T, Feigon, J. Deposit date: 1997-09-11 Release date: 1997-11-12 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Solution structure of a GAAA tetraloop receptor RNA. EMBO J., 16, 1997
2JWV	Structure of a high affinity anti-NFkB RNA aptamer Descriptor: RNA (29-MER) Authors: Reiter, N.J, Maher III, L, Butcher, S.E. Deposit date: 2007-10-25 Release date: 2008-01-08 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: DNA mimicry by a high-affinity anti-NF-kappaB RNA aptamer Nucleic Acids Res., 36, 2008
1I4C	THE SOLUTION STRUCTURE OF THE MINOR FAMILY OF THE MUTANT STEM LOOP C 5'UUA3' TRILOOP OF BROME MOSAIC VIRUS (+) STRAND RNA Descriptor: RNA (5'-R(*GP*GP*UP*GP*CP*UP*UP*AP*GP*CP*AP*CP*C)-3') Authors: Tinoco Jr, I, Kim, C.-H. Deposit date: 2001-02-20 Release date: 2001-04-21 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Structural and thermodynamic studies on mutant RNA motifs that impair the specificity between a viral replicase and its promoter. J.Mol.Biol., 307, 2001
1KOC	RNA APTAMER COMPLEXED WITH ARGININE, NMR Descriptor: ARGININE, RNA (5'-R(P*AP*CP*AP*GP*GP*UP*AP*GP*GP*UP*CP*GP*CP*U)-3'), RNA (5'-R(P*AP*GP*AP*AP*GP*GP*AP*GP*CP*GP*U)-3') Authors: Yang, Y.S, Kochoyan, M, Burgstaller, P, Westhof, E, Famulok, M. Deposit date: 1996-03-28 Release date: 1996-08-17 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Structural basis of ligand discrimination by two related RNA aptamers resolved by NMR spectroscopy. Science, 272, 1996
4JRT	Crystal structure of an A-form RNA duplex containing three GU base pairs Descriptor: RNA (5'-R(P*CP*CP*UP*GP*CP*AP*CP*UP*GP*CP*CP*C)-3'), RNA (5'-R(P*GP*GP*GP*UP*GP*GP*UP*GP*CP*GP*GP*G)-3') Authors: Kondo, J, Dock-Bregeon, A.C, Willkomm, D.K, Hartmann, R.K, Westhof, E. Deposit date: 2013-03-21 Release date: 2013-06-05 Last modified: 2023-11-08 Method: X-RAY DIFFRACTION (2.6 Å) Cite: Structure of an A-form RNA duplex obtained by degradation of 6S RNA in a crystallization droplet Acta Crystallogr.,Sect.F, 69, 2013
1KOD	RNA APTAMER COMPLEXED WITH CITRULLINE, NMR Descriptor: CITRULLINE, RNA (5'-R(P*AP*CP*GP*GP*UP*UP*AP*GP*GP*UP*CP*GP*CP*U)-3'), RNA (5'-R(P*AP*GP*AP*AP*GP*GP*AP*GP*UP*GP*U)-3') Authors: Yang, Y.S, Kochoyan, M, Burgstaller, P, Westhof, E, Famulok, M. Deposit date: 1996-03-28 Release date: 1996-11-08 Last modified: 2023-11-15 Method: SOLUTION NMR Cite: Structural basis of ligand discrimination by two related RNA aptamers resolved by NMR spectroscopy. Science, 272, 1996
3W5W	Mn2+-GMP complex of nanoRNase (Nrn) from Bacteroides fragilis Descriptor: GUANOSINE-5'-MONOPHOSPHATE, MANGANESE (II) ION, Putative exopolyphosphatase-related protein Authors: Uemura, Y, Nakagawa, N, Wakamatsu, T, Montelione, G.T, Hunt, J.F, Masui, R, Kuramitsu, S. Deposit date: 2013-02-07 Release date: 2013-07-10 Last modified: 2023-11-08 Method: X-RAY DIFFRACTION (2.95 Å) Cite: Crystal structure of the ligand-binding form of nanoRNase from Bacteroides fragilis, a member of the DHH/DHHA1 phosphoesterase family of proteins. Febs Lett., 587, 2013
7DD4	Solution structure of an RNA derived from the joint region of the TAR and PolyA stems of HIV-1 genomic RNA Descriptor: RNA (36-MER) Authors: Obayashi, C.M, Shinohara, Y, Masuda, T, Kawai, G. Deposit date: 2020-10-27 Release date: 2021-06-09 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Influence of the 5'-terminal sequences on the 5'-UTR structure of HIV-1 genomic RNA. Sci Rep, 11, 2021
5HN2	Base Pairing and Structure Insights into the 5-Formylcytosine in RNA Duplex Descriptor: RNA (5'-R(*GP*UP*AP*(OFC)P*GP*UP*AP*C)-3'), SODIUM ION Authors: Luo, Z.P, Sheng, J. Deposit date: 2016-01-18 Release date: 2016-04-27 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (1.5 Å) Cite: Base pairing and structural insights into the 5-formylcytosine in RNA duplex. Nucleic Acids Res., 44, 2016
5HNJ	Base Pairing and Structure Insights into the 5-Formylcytosine in RNA Duplex Descriptor: RNA (5'-R(*GP*UP*AP*(OFC)P*GP*UP*AP*C)-3'), SODIUM ION Authors: Luo, Z.P, Sheng, J. Deposit date: 2016-01-18 Release date: 2016-04-27 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (1.24 Å) Cite: Base pairing and structural insights into the 5-formylcytosine in RNA duplex. Nucleic Acids Res., 44, 2016
8FEP	16mer self-complementary duplex RNA with two continuous native U:U pairs Descriptor: RNA 16mer Authors: Fang, Z, Szostak, J.W. Deposit date: 2022-12-06 Release date: 2024-01-24 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (1.55 Å) Cite: Unusual Base Pair between Two 2-Thiouridines and Its Implication for Nonenzymatic RNA Copying. J.Am.Chem.Soc., 146, 2024
8FER	16mer self-complementary duplex RNA with two continuous s(2)U:s(2)U pairs Descriptor: RNA 16mer with two continuous s(2)U Authors: Fang, Z, Zhou, L, Szostak, J.W. Deposit date: 2022-12-06 Release date: 2024-01-24 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (1.54 Å) Cite: Unusual Base Pair between Two 2-Thiouridines and Its Implication for Nonenzymatic RNA Copying. J.Am.Chem.Soc., 146, 2024
2KYE	Solution structure of the pseudouridine modified P6.1 hairpin of human telomerase RNA Descriptor: RNA (5'-R(*GP*AP*GP*AP*GP*(PSU)P*(PSU)P*GP*GP*GP*CP*(PSU)P*CP*(PSU)P*C)-3') Authors: Kim, N.-K, Theimer, C.A, Mitchell, J.R, Collins, K, Feigon, J. Deposit date: 2010-05-25 Release date: 2010-06-30 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Effect of pseudouridylation on the structure and activity of the catalytically essential P6.1 hairpin in human telomerase RNA. Nucleic Acids Res., 38, 2010
2L8U	NMR Spectroscopy and Molecular Dynamics Simulation of r(CCGCUGCGG)2 Reveal a Dynamic UU Internal Loop Found in Myotonic Dystrophy Type 1 - UU pair with one hydrogen bond pair Descriptor: RNA (5'-R(*CP*CP*GP*CP*UP*GP*CP*GP*G)-3') Authors: Parkesh, R, Fountain, M.A, Disney, M.D. Deposit date: 2011-01-25 Release date: 2011-02-23 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: NMR Spectroscopy and Molecular Dynamics Simulation of r(CCGCUGCGG)(2) Reveal a Dynamic UU Internal Loop Found in Myotonic Dystrophy Type 1. Biochemistry, 50, 2011
2R7V	Crystal Structure of Rotavirus SA11 VP1/RNA (GGCUUU) Complex Descriptor: RNA (5'-R(*G*GP*CP*UP*UP*U)-3'), RNA-dependent RNA polymerase Authors: Lu, X, Harrison, S.C, Tao, Y.J, Patton, J.T, Nibert, M.L. Deposit date: 2007-09-10 Release date: 2008-07-29 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (2.8 Å) Cite: Mechanism for coordinated RNA packaging and genome replication by rotavirus polymerase VP1. Structure, 16, 2008
2R7U	Crystal Structure of Rotavirus SA11 VP1/RNA (AAAAGCC) Complex Descriptor: RNA (5'-R(*AP*A*AP*AP*GP*CP*C)-3'), RNA-dependent RNA polymerase Authors: Lu, X, Harrison, S.C, Tao, Y.J, Patton, J.T, Nibert, M.L. Deposit date: 2007-09-10 Release date: 2008-07-29 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (3.1 Å) Cite: Mechanism for coordinated RNA packaging and genome replication by rotavirus polymerase VP1. Structure, 16, 2008
8PFQ	RNA structure with 1-methylpseudoridine, P1 space group Descriptor: Chains: A,B, MAGNESIUM ION Authors: Spingler, B, McAuley, K, Nievergelt, P, Thorn, A. Deposit date: 2023-06-16 Release date: 2024-01-31 Last modified: 2024-05-01 Method: X-RAY DIFFRACTION (1.01 Å) Cite: RNA oligomers at atomic resolution containing 1-methylpseudouridine, an essential building block of mRNA vaccines. Chemmedchem, 19, 2024
7EFI	RNA kink-turn motif composed of RNA, DNA and 2'-O-methyl RNA Descriptor: DNA/RNA (5'-R(*GP*GP*CP*GP*AP*AP*GP*AP*AP*CP*CP*(OMG)P*(OMG)P*(OMG))-D(P*GP*A)-R(P*GP*(OMC)P*(OMC))-3') Authors: Kondo, J, Nagashima, M. Deposit date: 2021-03-21 Release date: 2022-03-30 Last modified: 2023-11-29 Method: X-RAY DIFFRACTION (2.9 Å) Cite: RNA kink-turn motif composed of RNA, DNA and 2'-O-methyl RNA To Be Published
2KYD	RDC and RCSA refinement of an A-form RNA: Improvements in Major Groove Width Descriptor: RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3') Authors: Tolbert, B.S, Summers, M.F, Miyazaki, Y, Barton, S, Kinde, B, Stark, P, Singh, R, Bax, A, Case, D. Deposit date: 2010-05-24 Release date: 2010-07-07 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Major groove width variations in RNA structures determined by NMR and impact of 13C residual chemical shift anisotropy and 1H-13C residual dipolar coupling on refinement. J.Biomol.Nmr, 47, 2010
2R7R	Crystal Structure of Rotavirus SA11 VP1/RNA (UGUGACC) complex Descriptor: RNA (5'-R(*UP*GP*UP*GP*AP*CP*C)-3'), RNA-dependent RNA polymerase Authors: Lu, X, Harrison, S.C, Tao, Y.J, Patton, J.T, Nibert, M.L. Deposit date: 2007-09-09 Release date: 2008-07-29 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (2.6 Å) Cite: Mechanism for coordinated RNA packaging and genome replication by rotavirus polymerase VP1. Structure, 16, 2008
2R7T	Crystal Structure of Rotavirus SA11 VP1/RNA (UGUGAACC) Complex Descriptor: RNA (5'-R(*UP*GP*UP*GP*AP*AP*CP*C)-3'), RNA-dependent RNA polymerase Authors: Lu, X, Harrison, S.C, Tao, Y.J, Patton, J.T, Nibert, M.L. Deposit date: 2007-09-10 Release date: 2008-07-29 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (3 Å) Cite: Mechanism for coordinated RNA packaging and genome replication by rotavirus polymerase VP1. Structure, 16, 2008
2L8W	r(CCGCUGCGG)2 UU Internal Loop Found in Myotonic Dystrophy Type 1 - UU pair with two hydrogen bond pairs Descriptor: RNA (5'-R(*CP*CP*GP*CP*UP*GP*CP*GP*G)-3') Authors: Parkesh, R, Fountain, M, Disney, M. Deposit date: 2011-01-26 Release date: 2011-02-23 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: NMR Spectroscopy and Molecular Dynamics Simulation of r(CCGCUGCGG)(2) Reveal a Dynamic UU Internal Loop Found in Myotonic Dystrophy Type 1. Biochemistry, 50, 2011

<147148149150151152153154155156157158159160161162>