PDB: 13252 resultsInfo pagesStatus searchChemie searchBIRD

---

2O5D	Thiazolone-acylsulfonamides as novel HCV NS5B polymerase allosteric inhibitors: Convergence of structure-based drug design and X-ray crystallographic study Descriptor: (2S)-2-({(5Z)-5-[(5-ETHYL-2-FURYL)METHYLENE]-4-OXO-4,5-DIHYDRO-1,3-THIAZOL-2-YL}AMINO)-2-(4-FLUOROPHENYL)-N-[(4-NITROPHENYL)SULFONYL]ACETAMIDE, HCV Authors: Yao, N. Deposit date: 2006-12-05 Release date: 2007-02-20 Last modified: 2023-12-27 Method: X-RAY DIFFRACTION (2.2 Å) Cite: Thiazolone-acylsulfonamides as novel HCV NS5B polymerase allosteric inhibitors: Convergence of structure-based drug design and X-ray crystallographic study. Bioorg.Med.Chem.Lett., 17, 2007
6Q4V	KlenTaq DNA polymerase in complex with dATP Descriptor: 1,2-ETHANEDIOL, 2'-DEOXYADENOSINE 5'-TRIPHOSPHATE, DNA (5'-D(*AP*AP*CP*TP*GP*TP*GP*GP*CP*CP*GP*TP*GP*GP*TP*C)-3'), ... Authors: Kropp, H.M, Diederichs, K, Marx, A. Deposit date: 2018-12-06 Release date: 2019-02-27 Last modified: 2024-01-24 Method: X-RAY DIFFRACTION (2.006 Å) Cite: The Structure of an Archaeal B-Family DNA Polymerase in Complex with a Chemically Modified Nucleotide. Angew.Chem.Int.Ed.Engl., 58, 2019
4WL1	Structure of WzzE Polysaccharide Co-polymerase Descriptor: Lipopolysaccharide biosynthesis protein WzzE Authors: Kalynych, S, Cherney, M, Cygler, M. Deposit date: 2014-10-05 Release date: 2014-10-29 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (5.989 Å) Cite: Quaternary structure of WzzB and WzzE polysaccharide copolymerases. Protein Sci., 24, 2015
7QHL	Crystal structure of Cyclin-dependent kinase 2/cyclin A in complex with 3,5,7-Substituted pyrazolo[4,3-d]pyrimidine inhibitor 24 Descriptor: 1,2-ETHANEDIOL, 5-(2-amino-1-ethyl)thio-3-cyclobutyl-7-[4-(pyrazol-1-yl)benzyl]amino-1(2)H-pyrazolo[4,3-d]pyrimidine, Cyclin-A2, ... Authors: Djukic, S, Skerlova, J, Rezacova, P. Deposit date: 2021-12-13 Release date: 2022-07-06 Last modified: 2024-01-31 Method: X-RAY DIFFRACTION (1.7 Å) Cite: 3,5,7-Substituted Pyrazolo[4,3- d ]Pyrimidine Inhibitors of Cyclin-Dependent Kinases and Cyclin K Degraders. J.Med.Chem., 65, 2022
6DCB	Structure of methylphosphate capping enzyme methyltransferase domain in complex with 5' end of 7SK RNA Descriptor: 7SK snRNA methylphosphate capping enzyme, S-ADENOSYL-L-HOMOCYSTEINE, SULFATE ION, ... Authors: Yang, Y, Eichhorn, C, Cascio, D, Feigon, J. Deposit date: 2018-05-04 Release date: 2018-12-19 Last modified: 2023-10-11 Method: X-RAY DIFFRACTION (1.998 Å) Cite: Structural basis of 7SK RNA 5'-gamma-phosphate methylation and retention by MePCE. Nat. Chem. Biol., 15, 2019
6DCC	Structure of methylphosphate capping enzyme methyltransferase domain in complex with 5' end of 7SK RNA Descriptor: 7SK snRNA methylphosphate capping enzyme, S-ADENOSYL-L-HOMOCYSTEINE, SULFATE ION, ... Authors: Yang, Y, Eichhorn, C, Cascio, D, Feigon, J. Deposit date: 2018-05-04 Release date: 2018-12-19 Last modified: 2023-10-11 Method: X-RAY DIFFRACTION (2.1 Å) Cite: Structural basis of 7SK RNA 5'-gamma-phosphate methylation and retention by MePCE. Nat. Chem. Biol., 15, 2019
1CLQ	CRYSTAL STRUCTURE OF A REPLICATION FORK DNA POLYMERASE EDITING COMPLEX AT 2.7 A RESOLUTION Descriptor: CALCIUM ION, DNA (5'-D(*AP*GP*TP*AP*GP*TP*TP*CP*CP*GP*CP*G)-3'), DNA (5'-D(*GP*CP*GP*GP*AP*AP*CP*TP*AP*CP*T)-3'), ... Authors: Shamoo, Y, Steitz, T.A. Deposit date: 1999-04-30 Release date: 1999-10-28 Last modified: 2023-08-02 Method: X-RAY DIFFRACTION (2.7 Å) Cite: Building a replisome from interacting pieces: sliding clamp complexed to a peptide from DNA polymerase and a polymerase editing complex. Cell(Cambridge,Mass.), 99, 1999
3PTX	Crystal Structure of a vesicular stomatitis virus nucleocapsid-polyA complex Descriptor: Nucleoprotein, RNA (45-MER), URANYL (VI) ION Authors: Luo, M, Green, T.J, Rowse, M. Deposit date: 2010-12-03 Release date: 2011-01-12 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (3 Å) Cite: Access to RNA Encapsidated in the Nucleocapsid of Vesicular Stomatitis Virus. J.Virol., 85, 2011
4FJI	RB69 DNA polymerase ternary complex with dcTP/dC Descriptor: 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, CALCIUM ION, DNA polymerase, ... Authors: Xia, S, Wang, J, Konigsberg, W.H. Deposit date: 2012-06-11 Release date: 2012-12-19 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (2.2 Å) Cite: DNA mismatch synthesis complexes provide insights into base selectivity of a B family DNA polymerase. J.Am.Chem.Soc., 135, 2013
1QWB	NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12 Descriptor: sNRE26 Authors: Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. Deposit date: 2003-09-01 Release date: 2003-11-25 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Solution Structures of Stem-loop RNAs that Bind the Two N-terminal RNA-binding Domains of Nucleolin Nucleic Acids Res., 31, 2003
4FJN	RB69 DNA polymerase ternary complex with dTTP/dA Descriptor: CALCIUM ION, DNA polymerase, DNA primer, ... Authors: Xia, S, Wang, J, Konigsberg, W.H. Deposit date: 2012-06-11 Release date: 2012-12-19 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (1.98 Å) Cite: DNA mismatch synthesis complexes provide insights into base selectivity of a B family DNA polymerase. J.Am.Chem.Soc., 135, 2013
3PU4	Crystal Structure of a vesicular stomatitis virus nucleocapsid-polyU complex Descriptor: Nucleoprotein, RNA (45-MER), URANYL (VI) ION Authors: Luo, M, Green, T.J, Rowse, M. Deposit date: 2010-12-03 Release date: 2011-01-12 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (3 Å) Cite: Access to RNA Encapsidated in the Nucleocapsid of Vesicular Stomatitis Virus. J.Virol., 85, 2011
3HW3	The crystal structure of avian influenza virus PA_N in complex with UMP Descriptor: MAGNESIUM ION, Polymerase acidic protein, URIDINE-5'-MONOPHOSPHATE Authors: Zhao, C, Lou, Z, Guo, Y, Ma, M, Chen, Y, Rao, Z. Deposit date: 2009-06-17 Release date: 2009-10-13 Last modified: 2023-11-01 Method: X-RAY DIFFRACTION (1.9 Å) Cite: Nucleoside monophosphate complex structures of the endonuclease domain from the influenza virus polymerase PA subunit reveal the substrate binding site inside the catalytic center J.Virol., 83, 2009
4FK2	RB69 DNA polymerase ternary complex with dTTP/dG Descriptor: CALCIUM ION, DNA polymerase, DNA primer, ... Authors: Xia, S, Wang, J, Konigsberg, W.H. Deposit date: 2012-06-12 Release date: 2012-12-19 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (1.98 Å) Cite: DNA mismatch synthesis complexes provide insights into base selectivity of a B family DNA polymerase. J.Am.Chem.Soc., 135, 2013
4FJG	RB69 DNA polymerase ternary complex with dATP/dC Descriptor: 2'-DEOXYADENOSINE 5'-TRIPHOSPHATE, CALCIUM ION, DNA polymerase, ... Authors: Xia, S, Wang, J, Konigsberg, W.H. Deposit date: 2012-06-11 Release date: 2012-12-19 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (2.02 Å) Cite: DNA mismatch synthesis complexes provide insights into base selectivity of a B family DNA polymerase. J.Am.Chem.Soc., 135, 2013
4FK0	RB69 DNA polymerase ternary complex with dCTP/dG Descriptor: 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, CALCIUM ION, DNA polymerase, ... Authors: Xia, S, Wang, J, Konigsberg, W.H. Deposit date: 2012-06-12 Release date: 2012-12-19 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (2.18 Å) Cite: DNA mismatch synthesis complexes provide insights into base selectivity of a B family DNA polymerase. J.Am.Chem.Soc., 135, 2013
4FJ9	RB69 DNA polymerase ternary complex with dTTP/dT Descriptor: CALCIUM ION, DNA polymerase, DNA primer, ... Authors: Xia, S, Wang, J, Konigsberg, W.H. Deposit date: 2012-06-11 Release date: 2012-12-19 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (1.97 Å) Cite: DNA mismatch synthesis complexes provide insights into base selectivity of a B family DNA polymerase. J.Am.Chem.Soc., 135, 2013
4FJX	RB69 DNA polymerase ternary complex with dATP/dG Descriptor: 2'-DEOXYADENOSINE 5'-TRIPHOSPHATE, CALCIUM ION, DNA polymerase, ... Authors: Xia, S, Wang, J, Konigsberg, W.H. Deposit date: 2012-06-12 Release date: 2012-12-19 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (2.11 Å) Cite: DNA mismatch synthesis complexes provide insights into base selectivity of a B family DNA polymerase. J.Am.Chem.Soc., 135, 2013
4FJH	RB69 DNA polymerase ternary complex with dGTP/dC Descriptor: 2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE, CALCIUM ION, DNA polymerase, ... Authors: Xia, S, Wang, J, Konigsberg, W.H. Deposit date: 2012-06-11 Release date: 2012-12-19 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (2.11 Å) Cite: DNA mismatch synthesis complexes provide insights into base selectivity of a B family DNA polymerase. J.Am.Chem.Soc., 135, 2013
4FJJ	RB69 DNA polymerase ternary complex with dTTP/dC Descriptor: CALCIUM ION, DNA polymerase, DNA primer, ... Authors: Xia, S, Wang, J, Konigsberg, W.H. Deposit date: 2012-06-11 Release date: 2012-12-19 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (1.99 Å) Cite: DNA mismatch synthesis complexes provide insights into base selectivity of a B family DNA polymerase. J.Am.Chem.Soc., 135, 2013
4FJ7	RB69 DNA polymerase ternary complex with dGTP/dT Descriptor: 2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE, CALCIUM ION, DNA polymerase, ... Authors: Xia, S, Wang, J, Konigsberg, W.H. Deposit date: 2012-06-11 Release date: 2012-12-19 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (1.9 Å) Cite: DNA mismatch synthesis complexes provide insights into base selectivity of a B family DNA polymerase. J.Am.Chem.Soc., 135, 2013
4FK4	RB69 DNA polymerase ternary complex with dGTP/dG Descriptor: 2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE, CALCIUM ION, DNA polymerase, ... Authors: Xia, S, Wang, J, Konigsberg, W.H. Deposit date: 2012-06-12 Release date: 2012-12-19 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (1.9 Å) Cite: DNA mismatch synthesis complexes provide insights into base selectivity of a B family DNA polymerase. J.Am.Chem.Soc., 135, 2013
3PU0	Crystal Structure of a vesicular stomatitis virus nucleocapsid-polyC complex Descriptor: Nucleoprotein, RNA (45-MER), URANYL (VI) ION Authors: Luo, M, Green, T.J, Rowse, M. Deposit date: 2010-12-03 Release date: 2011-01-12 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (3.09 Å) Cite: Access to RNA Encapsidated in the Nucleocapsid of Vesicular Stomatitis Virus. J.Virol., 85, 2011
3HW5	crystal structure of avian influenza virus PA_N in complex with AMP Descriptor: ADENOSINE MONOPHOSPHATE, MAGNESIUM ION, Polymerase acidic protein Authors: Zhao, C, Lou, Z, Guo, Y, Ma, M, Chen, Y, Liang, S, Rao, Z. Deposit date: 2009-06-17 Release date: 2009-10-13 Last modified: 2023-11-01 Method: X-RAY DIFFRACTION (1.81 Å) Cite: Nucleoside monophosphate complex structures of the endonuclease domain from the influenza virus polymerase PA subunit reveal the substrate binding site inside the catalytic center J.Virol., 83, 2009
3HW6	Crystal structure of avian influenza virus PA_N in complex with Mn Descriptor: MANGANESE (II) ION, Polymerase acidic protein Authors: Zhao, C, Lou, Z, Guo, Y, Ma, M, Chen, Y, Rao, Z. Deposit date: 2009-06-17 Release date: 2009-10-13 Last modified: 2023-11-01 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Nucleoside monophosphate complex structures of the endonuclease domain from the influenza virus polymerase PA subunit reveal the substrate binding site inside the catalytic center J.Virol., 83, 2009

<137138139140141142143144145146147148149150151152>