PDB: 224004 resultsInfo pagesStatus searchChemie searchBIRD

---

1SAK	HIGH RESOLUTION SOLUTION NMR STRUCTURE OF THE OLIGOMERIZATION DOMAIN OF P53 BY MULTI-DIMENSIONAL NMR (SAC STRUCTURES) Descriptor: TUMOR SUPPRESSOR P53 Authors: Clore, G.M, Omichinski, J.G, Gronenborn, A.M. Deposit date: 1995-03-12 Release date: 1995-10-15 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Refined solution structure of the oligomerization domain of the tumour suppressor p53. Nat.Struct.Biol., 2, 1995
1SAL	HIGH RESOLUTION SOLUTION NMR STRUCTURE OF THE OLIGOMERIZATION DOMAIN OF P53 BY MULTI-DIMENSIONAL NMR (SAD STRUCTURES) Descriptor: TUMOR SUPPRESSOR P53 Authors: Clore, G.M, Omichinski, J.G, Gronenborn, A.M. Deposit date: 1995-03-12 Release date: 1995-10-15 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Refined solution structure of the oligomerization domain of the tumour suppressor p53. Nat.Struct.Biol., 2, 1995
1SAN	THE DES(1-6)ANTENNAPEDIA HOMEODOMAIN: COMPARISON OF THE NMR SOLUTION STRUCTURE AND THE DNA BINDING AFFINITY WITH THE INTACT ANTENNAPEDIA HOMEODOMAIN Descriptor: ANTENNAPEDIA PROTEIN Authors: Qian, Y.Q, Resendez-Perez, D, Gehring, W.J, Wuthrich, K. Deposit date: 1994-01-07 Release date: 1994-04-30 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: The des(1-6)antennapedia homeodomain: comparison of the NMR solution structure and the DNA-binding affinity with the intact Antennapedia homeodomain. Proc.Natl.Acad.Sci.USA, 91, 1994
1SAP	HYPERTHERMOPHILE PROTEIN, RELAXATION MATRIX REFINEMENT STRUCTURE Descriptor: SAC7D Authors: Edmondson, S.P, Shriver, J.W. Deposit date: 1995-04-25 Release date: 1995-09-15 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Solution structure of the DNA-binding protein Sac7d from the hyperthermophile Sulfolobus acidocaldarius. Biochemistry, 34, 1995
1SAQ	Crystal Structure of the RNA octamer GIC(GA)GCC Descriptor: 5'-R(*GP*IP*CP*GP*AP*GP*CP*C)-3' Authors: Jang, S.B, Baeyens, K, Jeong, M.S, SantaLucia Jr, J, Turner, D, Holbrook, S.R. Deposit date: 2004-02-09 Release date: 2004-05-18 Last modified: 2024-03-13 Method: X-RAY DIFFRACTION (2.7 Å) Cite: Structures of two RNA octamers containing tandem G.A base pairs. Acta Crystallogr.,Sect.D, 60, 2004
1SAR	DETERMINATION AND RESTRAINED LEAST-SQUARES REFINEMENT OF THE CRYSTAL STRUCTURES OF RIBONUCLEASE SA AND ITS COMPLEX WITH 3'-GUANYLIC ACID AT 1.8 ANGSTROMS RESOLUTION Descriptor: RIBONUCLEASE SA, SULFATE ION Authors: Sevcik, J, Dodson, E.J, Dodson, G.G. Deposit date: 1990-12-13 Release date: 1992-04-15 Last modified: 2017-11-29 Method: X-RAY DIFFRACTION (1.8 Å) Cite: Determination and restrained least-squares refinement of the structures of ribonuclease Sa and its complex with 3'-guanylic acid at 1.8 A resolution. Acta Crystallogr.,Sect.B, 47, 1991
1SAT	CRYSTAL STRUCTURE OF THE 50 KDA METALLO PROTEASE FROM S. MARCESCENS Descriptor: CALCIUM ION, SERRATIA PROTEASE, ZINC ION Authors: Baumann, U. Deposit date: 1994-07-04 Release date: 1995-07-31 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (1.75 Å) Cite: Crystal structure of the 50 kDa metallo protease from Serratia marcescens. J.Mol.Biol., 242, 1994
1SAU	The Gamma subunit of the dissimilatory sulfite reductase (DsrC) from Archaeoglobus fulgidus at 1.1 A resolution Descriptor: sulfite reductase, desulfoviridin-type subunit gamma Authors: Mander, G.J, Weiss, M.S, Hedderich, R, Kahnt, J, Ermler, U, Warkentin, E. Deposit date: 2004-02-09 Release date: 2005-02-15 Last modified: 2011-07-13 Method: X-RAY DIFFRACTION (1.12 Å) Cite: Determination of a novel structure by a combination of long-wavelength sulfur phasing and radiation-damage-induced phasing. Acta Crystallogr.,Sect.D, 60, 2004
1SAV	HUMAN ANNEXIN V WITH PROLINE SUBSTITUTION BY THIOPROLINE Descriptor: ANNEXIN V, CALCIUM ION Authors: Medrano, F.J, Minks, C, Budisa, N, Huber, R. Deposit date: 1997-11-24 Release date: 1998-05-27 Last modified: 2023-08-09 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Crystal and molecular structure of human annexin V after refinement. Implications for structure, membrane binding and ion channel formation of the annexin family of proteins. J.Mol.Biol., 223, 1992
1SAW	X-ray structure of homo sapiens protein FLJ36880 Descriptor: CHLORIDE ION, MAGNESIUM ION, hypothetical protein FLJ36880 Authors: Manjasetty, B.A, Niesen, F.H, Delbrueck, H, Goetz, F, Sievert, V, Buessow, K, Behlke, J, Heinemann, U. Deposit date: 2004-02-09 Release date: 2004-10-12 Last modified: 2023-08-23 Method: X-RAY DIFFRACTION (2.2 Å) Cite: X-ray structure of fumarylacetoacetate hydrolase family member Homo sapiens FLJ36880. Biol.Chem., 385, 2004
1SAX	Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA Descriptor: 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... Authors: Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. Deposit date: 2004-02-09 Release date: 2004-04-27 Last modified: 2023-08-23 Method: X-RAY DIFFRACTION (2.8 Å) Cite: On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator J.Biol.Chem., 279, 2004
1SAY	L-ALANINE DEHYDROGENASE COMPLEXED WITH PYRUVATE Descriptor: L-ALANINE DEHYDROGENASE, PYRUVIC ACID Authors: Baker, P.J, Sawa, Y, Shibata, H, Sedelnikova, S.E, Rice, D.W. Deposit date: 1998-06-05 Release date: 1999-06-08 Last modified: 2023-11-15 Method: X-RAY DIFFRACTION (2.1 Å) Cite: Analysis of the structure and substrate binding of Phormidium lapideum alanine dehydrogenase. Nat.Struct.Biol., 5, 1998
1SAZ	Membership in the ASKHA Superfamily: Enzymological Properties and Crystal Structure of Butyrate Kinase 2 from Thermotoga maritima Descriptor: FORMIC ACID, PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER, Probable butyrate kinase 2, ... Authors: Diao, J, Cooper, D.R, Sanders, D.A, Hasson, M.S. Deposit date: 2004-02-09 Release date: 2005-03-29 Last modified: 2011-07-13 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Crystal structure of butyrate kinase 2 from Thermotoga maritima, a member of the ASKHA superfamily of phosphotransferases. J.Bacteriol., 191, 2009
1SB0	Solution structure of the KIX domain of CBP bound to the transactivation domain of c-Myb Descriptor: protein CBP, protein c-Myb Authors: Zor, T, De Guzman, R.N, Dyson, H.J, Wright, P.E. Deposit date: 2004-02-09 Release date: 2004-04-13 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Solution Structure of the KIX Domain of CBP Bound to the Transactivation Domain of c-Myb J.Mol.Biol., 337, 2004
1SB1	Novel Non-Covalent Thrombin Inhibitors Incorporating P1 4,5,6,7-Tetrahydrobenzothiazole Arginine Side Chain Mimetics Descriptor: N-(BENZYLSULFONYL)-3-CYCLOHEXYLALANYL-N-(2-AMINO-1,3-BENZOTHIAZOL-6-YL)PROLINAMIDE, Prothrombin, SODIUM ION, ... Authors: Marinko, P, Krbavcic, A, Mlinsek, G, Solmajer, T, Trampus-Bakija, A, Stegnar, M, Stojan, J, Kikelj, D. Deposit date: 2004-02-09 Release date: 2004-06-08 Last modified: 2011-11-16 Method: X-RAY DIFFRACTION (1.9 Å) Cite: Novel non-covalent thrombin inhibitors incorporating P(1) 4,5,6,7-tetrahydrobenzothiazole arginine side chain mimetics Eur.J.Med.Chem., 39, 2004
1SB2	High resolution Structure determination of rhodocetin Descriptor: Rhodocetin alpha subunit, Rhodocetin beta subunit Authors: Paaventhan, P, Kong, C.G, Joseph, J.S, Chung, M.C.M, Kolatkar, P.R. Deposit date: 2004-02-10 Release date: 2005-02-01 Last modified: 2011-07-13 Method: X-RAY DIFFRACTION (1.9 Å) Cite: Structure of rhodocetin reveals noncovalently bound heterodimer interface Protein Sci., 14, 2005
1SB3	Structure of 4-hydroxybenzoyl-CoA reductase from Thauera aromatica Descriptor: (MOLYBDOPTERIN-CYTOSINE DINUCLEOTIDE-S,S)-DIOXO-AQUA-MOLYBDENUM(V), 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, 4-hydroxybenzoyl-CoA reductase alpha subunit, ... Authors: Unciuleac, M, Warkentin, E, Page, C.C, Boll, M, Ermler, U. Deposit date: 2004-02-10 Release date: 2004-12-21 Last modified: 2023-08-23 Method: X-RAY DIFFRACTION (2.2 Å) Cite: Structure of a Xanthine Oxidase-Related 4-Hydroxybenzoyl-CoA Reductase with an Additional [4Fe-4S] Cluster and an Inverted Electron Flow. Structure, 12, 2004
1SB6	Solution structure of a cyanobacterial copper metallochaperone, ScAtx1 Descriptor: copper chaperone ScAtx1 Authors: Banci, L, Bertini, I, Ciofi-Baffoni, S, Su, X.C, Borrelly, G.P, Robinson, N.J, Structural Proteomics in Europe (SPINE) Deposit date: 2004-02-10 Release date: 2004-04-27 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Solution Structures of a Cyanobacterial Metallochaperone: INSIGHT INTO AN ATYPICAL COPPER-BINDING MOTIF. J.Biol.Chem., 279, 2004
1SB7	Crystal structure of the E.coli pseudouridine synthase TruD Descriptor: GLYCEROL, PHOSPHATE ION, tRNA pseudouridine synthase D Authors: Hoang, C, Ferre-D'Amare, A.R. Deposit date: 2004-02-10 Release date: 2004-06-29 Last modified: 2011-07-13 Method: X-RAY DIFFRACTION (2.2 Å) Cite: Crystal structure of the highly divergent pseudouridine synthase TruD reveals a circular permutation of a conserved fold. Rna, 10, 2004
1SB8	Crystal structure of Pseudomonas aeruginosa UDP-N-acetylglucosamine 4-epimerase complexed with UDP-N-acetylgalactosamine Descriptor: NICOTINAMIDE-ADENINE-DINUCLEOTIDE, URIDINE-DIPHOSPHATE-N-ACETYLGALACTOSAMINE, wbpP Authors: Ishiyama, N, Creuzenet, C, Lam, J.S, Berghuis, A.M. Deposit date: 2004-02-10 Release date: 2004-05-25 Last modified: 2023-08-23 Method: X-RAY DIFFRACTION (2.1 Å) Cite: Crystal Structure of WbpP, a Genuine UDP-N-acetylglucosamine 4-Epimerase from Pseudomonas aeruginosa: SUBSTRATE SPECIFICITY IN UDP-HEXOSE 4-EPIMERASES. J.Biol.Chem., 279, 2004
1SB9	Crystal structure of Pseudomonas aeruginosa UDP-N-acetylglucosamine 4-epimerase complexed with UDP-glucose Descriptor: NICOTINAMIDE-ADENINE-DINUCLEOTIDE, URIDINE-5'-DIPHOSPHATE-GLUCOSE, wbpP Authors: Ishiyama, N, Creuzenet, C, Lam, J.S, Berghuis, A.M. Deposit date: 2004-02-10 Release date: 2004-05-25 Last modified: 2023-08-23 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Crystal Structure of WbpP, a Genuine UDP-N-acetylglucosamine 4-Epimerase from Pseudomonas aeruginosa: SUBSTRATE SPECIFICITY IN UDP-HEXOSE 4-EPIMERASES. J.Biol.Chem., 279, 2004
1SBB	T-CELL RECEPTOR BETA CHAIN COMPLEXED WITH SUPERANTIGEN SEB Descriptor: PROTEIN (14.3.D T CELL ANTIGEN RECEPTOR), PROTEIN (STAPHYLOCOCCAL ENTEROTOXIN B) Authors: Li, H, Mariuzza, R.A. Deposit date: 1999-02-22 Release date: 1999-03-01 Last modified: 2023-08-23 Method: X-RAY DIFFRACTION (2.4 Å) Cite: Three-dimensional structure of the complex between a T cell receptor beta chain and the superantigen staphylococcal enterotoxin B. Immunity, 9, 1998
1SBC	THE REFINED CRYSTAL STRUCTURE OF SUBTILISIN CARLSBERG AT 2.5 ANGSTROMS RESOLUTION Descriptor: CALCIUM ION, SUBTILISIN CARLSBERG Authors: Neidhart, D.J, Petsko, G.A. Deposit date: 1988-05-13 Release date: 1988-07-16 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (2.5 Å) Cite: The refined crystal structure of subtilisin Carlsberg at 2.5 A resolution. Protein Eng., 2, 1988
1SBD	SOYBEAN AGGLUTININ COMPLEXED WITH 2,4-PENTASACCHARIDE Descriptor: CALCIUM ION, MANGANESE (II) ION, SOYBEAN AGGLUTININ, ... Authors: Dessen, A, Olsen, L.R, Gupta, D, Sabesan, S, Brewer, C.F, Sacchettini, J.C. Deposit date: 1995-07-13 Release date: 1998-04-22 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (2.52 Å) Cite: X-ray crystallographic studies of unique cross-linked lattices between four isomeric biantennary oligosaccharides and soybean agglutinin. Biochemistry, 36, 1997
1SBE	SOYBEAN AGGLUTININ FROM GLYCINE MAX Descriptor: 2-acetamido-2-deoxy-beta-D-glucopyranose, CALCIUM ION, MANGANESE (II) ION, ... Authors: Dessen, A, Olsen, L.R, Gupta, D, Sabesan, S, Sacchettini, J.C, Brewer, C.F. Deposit date: 1995-07-13 Release date: 1998-04-22 Last modified: 2020-07-29 Method: X-RAY DIFFRACTION (2.8 Å) Cite: X-ray crystallographic studies of unique cross-linked lattices between four isomeric biantennary oligosaccharides and soybean agglutinin. Biochemistry, 36, 1997

<852853854855856857858859860861862863864865866867>