8EAJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8eaj by Molmil](/molmil-images/mine/8eaj) | SsoMCM hexamer bound to Mg/ADP-BeFx and 46-mer DNA strand. Class 1 | Descriptor: | 46-mer DNA strand, MAGNESIUM ION, Minichromosome maintenance protein MCM, ... | Authors: | Meagher, M, Myasnikov, A, Enemark, E.J. | Deposit date: | 2022-08-29 | Release date: | 2022-12-14 | Last modified: | 2024-06-19 | Method: | ELECTRON MICROSCOPY (2.45 Å) | Cite: | Two Distinct Modes of DNA Binding by an MCM Helicase Enable DNA Translocation. Int J Mol Sci, 23, 2022
|
|
7QFW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7qfw by Molmil](/molmil-images/mine/7qfw) | S.c. Condensin peripheral Ycg1 subcomplex bound to DNA | Descriptor: | Condensin complex subunit 2, Condensin complex subunit 3, Synthetic DNA ligand, ... | Authors: | Lecomte, L, Hassler, M, Haering, C, Eustermann, S. | Deposit date: | 2021-12-06 | Release date: | 2022-06-15 | Last modified: | 2024-07-17 | Method: | ELECTRON MICROSCOPY (3.86 Å) | Cite: | A hold-and-feed mechanism drives directional DNA loop extrusion by condensin. Science, 376, 2022
|
|
7WNR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7wnr by Molmil](/molmil-images/mine/7wnr) | Data-driven HADDOCK model of mycobacterial nMazE6-operator DNA complex | Descriptor: | Antitoxin MazE6, DNA (5'-D(P*CP*CP*GP*GP*TP*TP*AP*TP*AP*CP*TP*AP*TP*CP*TP*GP*TP*A)-3'), DNA (5'-D(P*TP*AP*CP*AP*GP*AP*TP*AP*GP*TP*AP*TP*AP*AP*CP*CP*GP*G)-3') | Authors: | Kumari, K, Sarma, S.P. | Deposit date: | 2022-01-19 | Release date: | 2022-10-12 | Last modified: | 2024-05-15 | Method: | SOLUTION NMR | Cite: | Structural and mutational analysis of MazE6-operator DNA complex provide insights into autoregulation of toxin-antitoxin systems. Commun Biol, 5, 2022
|
|
6C1Y
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6c1y by Molmil](/molmil-images/mine/6c1y) | mbd of human mecp2 in complex with methylated DNA | Descriptor: | 12-mer DNA, Methyl-CpG-binding protein 2, UNKNOWN ATOM OR ION | Authors: | Liu, K, Bian, C, Tempel, W, Wernimont, A.K, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Min, J, Structural Genomics Consortium (SGC) | Deposit date: | 2018-01-05 | Release date: | 2018-02-14 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Plasticity at the DNA recognition site of the MeCP2 mCG-binding domain. Biochim Biophys Acta Gene Regul Mech, 1862, 2019
|
|
1SFE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1sfe by Molmil](/molmil-images/mine/1sfe) | ADA O6-METHYLGUANINE-DNA METHYLTRANSFERASE FROM ESCHERICHIA COLI | Descriptor: | ADA O6-METHYLGUANINE-DNA METHYLTRANSFERASE | Authors: | Moore, M.H, Gulbis, J.M, Dodson, E.J, Demple, B, Moody, P.C.E. | Deposit date: | 1996-06-21 | Release date: | 1996-12-23 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Crystal structure of a suicidal DNA repair protein: the Ada O6-methylguanine-DNA methyltransferase from E. coli. EMBO J., 13, 1994
|
|
5ZAS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5zas by Molmil](/molmil-images/mine/5zas) | Crystal structure of 5-formylcytosine containing decamer dsDNA | Descriptor: | BICARBONATE ION, DNA (5'-D(*CP*CP*AP*GP*(5FC)P*GP*CP*TP*GP*G)-3') | Authors: | Fu, T.R, Zhang, L. | Deposit date: | 2018-02-08 | Release date: | 2019-02-13 | Last modified: | 2024-03-27 | Method: | X-RAY DIFFRACTION (1.56 Å) | Cite: | Thymine DNA glycosylase recognizes the geometry alteration of minor grooves induced by 5-formylcytosine and 5-carboxylcytosine. Chem Sci, 10, 2019
|
|
6ROU
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6rou by Molmil](/molmil-images/mine/6rou) | REP related 18-mer DNA | Descriptor: | REP related 18-mer DNA from H. parasuis, STRONTIUM ION | Authors: | Kolenko, P, Svoboda, J, Schneider, B. | Deposit date: | 2019-05-13 | Release date: | 2020-07-08 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (2.902 Å) | Cite: | Structural variability of CG-rich DNA 18-mers accommodating double T-T mismatches. Acta Crystallogr D Struct Biol, 76, 2020
|
|
6S2F
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6s2f by Molmil](/molmil-images/mine/6s2f) | |
1XQP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1xqp by Molmil](/molmil-images/mine/1xqp) | Crystal structure of 8-oxoguanosine complexed Pa-AGOG, 8-oxoguanine DNA glycosylase from Pyrobaculum aerophilum | Descriptor: | 2'-DEOXY-8-OXOGUANOSINE, 8-oxoguanine DNA glycosylase | Authors: | Lingaraju, G.M, Sartori, A.A, Kostrewa, D, Prota, A.E, Jiricny, J, Winkler, F.K. | Deposit date: | 2004-10-13 | Release date: | 2004-11-16 | Last modified: | 2017-10-11 | Method: | X-RAY DIFFRACTION (1.69 Å) | Cite: | A DNA glycosylase from Pyrobaculum aerophilum with an 8-oxoguanine binding mode and a noncanonical helix-hairpin-helix structure Structure, 13, 2005
|
|
3V4R
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3v4r by Molmil](/molmil-images/mine/3v4r) | Crystal structure of a UvrB dimer-DNA complex | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, DNA: 5 -TACTGTTT-3, UvrABC system protein B | Authors: | Webster, M.P.J, Jukes, R, Barrett, T. | Deposit date: | 2011-12-15 | Release date: | 2012-07-04 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (3.25 Å) | Cite: | Crystal structure of the UvrB dimer: insights into the nature and functioning of the UvrAB damage engagement and UvrB-DNA complexes. Nucleic Acids Res., 40, 2012
|
|
1XQO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1xqo by Molmil](/molmil-images/mine/1xqo) | Crystal structure of native Pa-AGOG, 8-oxoguanine DNA glycosylase from Pyrobaculum aerophilum | Descriptor: | 8-oxoguanine DNA glycosylase | Authors: | Lingaraju, G.M, Sartori, A.A, Kostrewa, D, Prota, A.E, Jiricny, J, Winkler, F.K. | Deposit date: | 2004-10-13 | Release date: | 2004-11-16 | Last modified: | 2017-10-11 | Method: | X-RAY DIFFRACTION (1.03 Å) | Cite: | A DNA glycosylase from Pyrobaculum aerophilum with an 8-oxoguanine binding mode and a noncanonical helix-hairpin-helix structure Structure, 13, 2005
|
|
6BUX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6bux by Molmil](/molmil-images/mine/6bux) | CRYSTAL STRUCTURE OF APOBEC3G CATALYTIC DOMAIN COMPLEX WITH SUBSTRATE SSDNA | Descriptor: | Apolipoprotein B mRNA editing enzyme catalytic subunit 3G catalytic domain, DNA (5'-D(*AP*AP*TP*CP*CP*CP*AP*AP*A)-3'), GLYCEROL, ... | Authors: | Maiti, A, Matsuo, H. | Deposit date: | 2017-12-11 | Release date: | 2018-07-18 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (1.856 Å) | Cite: | Crystal structure of the catalytic domain of HIV-1 restriction factor APOBEC3G in complex with ssDNA. Nat Commun, 9, 2018
|
|
3N7Q
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3n7q by Molmil](/molmil-images/mine/3n7q) | Crystal structure of human mitochondrial mTERF fragment (aa 99-399) in complex with a 12-mer DNA encompassing the tRNALeu(UUR) binding sequence | Descriptor: | CITRIC ACID, DNA (5'-D(*CP*CP*GP*GP*GP*CP*TP*CP*TP*GP*CP*C)-3'), DNA (5'-D(*GP*GP*CP*AP*GP*AP*GP*CP*CP*CP*GP*G)-3'), ... | Authors: | Jimenez-Menendez, N, Fernandez-Millan, P, Rubio-Cosials, A, Arnan, C, Montoya, J, Jacobs, H.T, Bernado, P, Coll, M, Uson, I, Sola, M. | Deposit date: | 2010-05-27 | Release date: | 2010-06-16 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Human mitochondrial mTERF wraps around DNA through a left-handed superhelical tandem repeat. Nat.Struct.Mol.Biol., 17, 2010
|
|
6U7T
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6u7t by Molmil](/molmil-images/mine/6u7t) | MutY adenine glycosylase bound to DNA containing a transition state analog (1N) paired with d(8-oxo-G) | Descriptor: | Adenine DNA glycosylase, CALCIUM ION, DNA (5'-D(*AP*AP*GP*AP*CP*(8OG)P*TP*GP*GP*AP*C)-3'), ... | Authors: | O'Shea Murray, V.L, Cao, S, Horvath, M.P, David, S.S. | Deposit date: | 2019-09-03 | Release date: | 2019-10-02 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Structural Basis for Finding OG Lesions and Avoiding Undamaged G by the DNA Glycosylase MutY. Acs Chem.Biol., 15, 2020
|
|
5UND
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5und by Molmil](/molmil-images/mine/5und) | |
5EWG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ewg by Molmil](/molmil-images/mine/5ewg) | Ternary complex of human DNA polymerase eta inserting rATP opposite an 8-Oxodeoxyguanosine Lesion | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, CALCIUM ION, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3'), ... | Authors: | Su, Y, Egli, M, Guengerich, F.P. | Deposit date: | 2015-11-20 | Release date: | 2016-01-13 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (1.75 Å) | Cite: | Mechanism of Ribonucleotide Incorporation by Human DNA Polymerase eta. J.Biol.Chem., 291, 2016
|
|
5EWF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ewf by Molmil](/molmil-images/mine/5ewf) | Ternary complex of human DNA polymerase eta inserting rCTP opposite an 8-Oxodeoxyguanosine Lesion | Descriptor: | CALCIUM ION, CYTIDINE-5'-TRIPHOSPHATE, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3'), ... | Authors: | Su, Y, Egli, M, Guengerich, F.P. | Deposit date: | 2015-11-20 | Release date: | 2016-01-13 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (1.782 Å) | Cite: | Mechanism of Ribonucleotide Incorporation by Human DNA Polymerase eta. J.Biol.Chem., 291, 2016
|
|
5EWE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ewe by Molmil](/molmil-images/mine/5ewe) | Ternary complex of human DNA polymerase eta inserting rCTP opposite template G | Descriptor: | CALCIUM ION, CYTIDINE-5'-TRIPHOSPHATE, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3'), ... | Authors: | Su, Y, Egli, M, Guengerich, F.P. | Deposit date: | 2015-11-20 | Release date: | 2016-01-13 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (1.66 Å) | Cite: | Mechanism of Ribonucleotide Incorporation by Human DNA Polymerase eta. J.Biol.Chem., 291, 2016
|
|
4FS6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4fs6 by Molmil](/molmil-images/mine/4fs6) | Crystal structure of the Z-DNA hexamer CGCGCG at 500 mM CaCl2 | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (5'-D(*CP*GP*CP*GP*CP*G)-3') | Authors: | Chatake, T, Sunami, T. | Deposit date: | 2012-06-27 | Release date: | 2013-05-15 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (1.3 Å) | Cite: | Direct interactions between Z-DNA and alkaline earth cations, discovered in the presence of high concentrations of MgCl2 and CaCl2 J.Inorg.Biochem., 124, 2013
|
|
4P0Q
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4p0q by Molmil](/molmil-images/mine/4p0q) | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.851 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4P0S
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4p0s by Molmil](/molmil-images/mine/4p0s) | human Mus81-Eme1-3'flap DNA complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCT, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (6 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
3V81
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3v81 by Molmil](/molmil-images/mine/3v81) | Crystal structure of HIV-1 reverse transcriptase (RT) with DNA and the nonnucleoside inhibitor nevirapine | Descriptor: | 11-CYCLOPROPYL-5,11-DIHYDRO-4-METHYL-6H-DIPYRIDO[3,2-B:2',3'-E][1,4]DIAZEPIN-6-ONE, DNA (5'-D(*A*CP*AP*GP*TP*CP*CP*CP*TP*GP*TP*TP*CP*GP*GP*(MRG)P*CP*GP*CP*CP*(ATM))-3'), DNA (5'-D(*AP*TP*GP*GP*AP*AP*GP*GP*CP*GP*CP*CP*CP*GP*AP*AP*CP*AP*GP*GP*GP*AP*CP*TP*GP*TP*G)-3'), ... | Authors: | Das, K, Martinez, S.E, Arnold, E. | Deposit date: | 2011-12-22 | Release date: | 2012-01-18 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (2.8503 Å) | Cite: | HIV-1 reverse transcriptase complex with DNA and nevirapine reveals non-nucleoside inhibition mechanism. Nat.Struct.Mol.Biol., 19, 2012
|
|
4P0R
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4p0r by Molmil](/molmil-images/mine/4p0r) | human Mus81-Eme1-3'flap DNA complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (6.501 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
1EQQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1eqq by Molmil](/molmil-images/mine/1eqq) | SINGLE STRANDED DNA BINDING PROTEIN AND SSDNA COMPLEX | Descriptor: | 5'-R(*(5MU)P*(5MU)P*(5MU))-3', SINGLE STRANDED DNA BINDING PROTEIN | Authors: | Matsumoto, T, Morimoto, Y, Shibata, N, Yasuoka, N, Shimamoto, N. | Deposit date: | 2000-04-06 | Release date: | 2003-09-23 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | Roles of functional loops and the C-terminal segment of a single-stranded DNA binding protein elucidated by X-Ray structure analysis J.Biochem.(Tokyo), 127, 2000
|
|
3DVO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3dvo by Molmil](/molmil-images/mine/3dvo) | SgrAI with cognate DNA and calcium bound | Descriptor: | CALCIUM ION, DNA (5'-D(*DGP*DAP*DGP*DTP*DCP*DCP*DAP*DCP*DCP*DGP*DGP*DTP*DGP*DGP*DAP*DCP*DTP*DC)-3'), SgraIR restriction enzyme | Authors: | Dunten, P.W, Horton, N.C, Little, E.J. | Deposit date: | 2008-07-18 | Release date: | 2008-08-19 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (1.892 Å) | Cite: | The structure of SgrAI bound to DNA; recognition of an 8 base pair target. Nucleic Acids Res., 36, 2008
|
|