3BVN
 
 | | High resolution crystal structure of HLA-B*1402 in complex with the latent membrane protein 2 peptide (LMP2) of Epstein-Barr virus | | Descriptor: | Beta-2-microglobulin, HLA class I histocompatibility antigen, B*1402 alpha chain, ... | | Authors: | Kumar, P, Vahedi-Faridi, A, Saenger, W, Uchanska-Ziegler, B, Ziegler, A. | | Deposit date: | 2008-01-07 | | Release date: | 2009-02-03 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.55 Å) | | Cite: | Structural basis for T cell alloreactivity among three HLA-B14 and HLA-B27 antigens
J.Biol.Chem., 284, 2009
|
|
6K59
 | |
1W6Y
 | | crystal structure of a mutant W92A in ketosteroid isomerase (KSI) from Pseudomonas putida biotype B | | Descriptor: | BETA-MERCAPTOETHANOL, EQUILENIN, STEROID DELTA-ISOMERASE | | Authors: | Yun, Y.S, Nam, G.H, Kim, Y.-G, Oh, B.-H, Choi, K.Y. | | Deposit date: | 2004-08-25 | | Release date: | 2005-04-14 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Small Exterior Hydrophobic Cluster Contributes to Conformational Stability and Steroid Binding in Ketosteroid Isomerase from Pseudomonas Putida Biotype B
FEBS J., 272, 2005
|
|
4FQK
 | | Influenza B/Brisbane/60/2008 hemagglutinin Fab CR8059 complex | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Antibody CR8059 Heavy Chain, ... | | Authors: | Dreyfus, C, Laursen, N.S, Wilson, I.A. | | Deposit date: | 2012-06-25 | | Release date: | 2012-08-22 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (5.65 Å) | | Cite: | Highly conserved protective epitopes on influenza B viruses.
Science, 337, 2012
|
|
4FQJ
 | | Influenza B/Florida/4/2006 hemagglutinin Fab CR8071 complex | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Hemagglutinin, antibody CR8071 heavy chain, ... | | Authors: | Dreyfus, C, Laursen, N.S, Wilson, I.A. | | Deposit date: | 2012-06-25 | | Release date: | 2012-08-22 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Highly conserved protective epitopes on influenza B viruses.
Science, 337, 2012
|
|
1D97
 | | CHIRAL PHOSPHOROTHIOATE ANALOGUES OF B-DNA: THE CRYSTAL STRUCTURE OF RP-D(GP(S) CPGP(S)CPGP(S)C) | | Descriptor: | DNA (5'-D(RP*GP*(SC)P*GP*(SC)P*GP*(SC))-3') | | Authors: | Cruse, W.B.T, Salisbury, S.A, Brown, T, Cosstick, R, Eckstein, F, Kennard, O. | | Deposit date: | 1992-10-17 | | Release date: | 1993-07-15 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.17 Å) | | Cite: | Chiral phosphorothioate analogues of B-DNA. The crystal structure of Rp-d[Gp(S)CpGp(S)CpGp(S)C].
J.Mol.Biol., 192, 1986
|
|
1K08
 | | Crystallographic Binding Study of 10 mM N-benzoyl-N'-beta-D-glucopyranosyl urea to glycogen phosphorylase b | | Descriptor: | Glycogen Phosphorylase, N-[(phenylcarbonyl)carbamoyl]-beta-D-glucopyranosylamine, PYRIDOXAL-5'-PHOSPHATE | | Authors: | Oikonomakos, N.G, Kosmopoulou, M, Zographos, S.E, Leonidas, D.D, Chrysina, E.D, Somsak, L, Nagy, V, Praly, J.P, Docsa, T, Toth, B, Gergely, P. | | Deposit date: | 2001-09-18 | | Release date: | 2001-10-03 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.26 Å) | | Cite: | Binding of N-acetyl-N '-beta-D-glucopyranosyl urea and N-benzoyl-N '-beta-D-glucopyranosyl urea to glycogen phosphorylase b: kinetic and crystallographic studies.
Eur.J.Biochem., 269, 2002
|
|
3EXV
 | |
3EX9
 | |
2JA4
 | | Crystal structure of CD5 domain III reveals the fold of a group B scavenger cysteine-rich receptor | | Descriptor: | T-CELL SURFACE GLYCOPROTEIN CD5 | | Authors: | Rodamilans, B, Munoz, I.G, Sarrias, M.R, Lozano, F, Blanco, F.J, Montoya, G. | | Deposit date: | 2006-11-21 | | Release date: | 2007-03-06 | | Last modified: | 2017-06-28 | | Method: | X-RAY DIFFRACTION (2.21 Å) | | Cite: | Crystal Structure of the Third Extracellular Domain of Cd5 Reveals the Fold of a Group B Scavenger Cysteine-Rich Receptor Domain.
J.Biol.Chem., 282, 2007
|
|
3ZDI
 | | Glycogen Synthase Kinase 3 Beta complexed with Axin Peptide and Inhibitor 7d | | Descriptor: | 3,6-Diamino-4-(2-chlorophenyl)thieno[2,3-b]pyridine-2,5-dicarbonitrile, AXIN-1, GLYCOGEN SYNTHASE KINASE-3 BETA, ... | | Authors: | Oberholzer, A.E, Pearl, L.H. | | Deposit date: | 2012-11-27 | | Release date: | 2012-12-26 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.645 Å) | | Cite: | 3,6-Diamino-4-(2-Halophenyl)-2-Benzoylthieno(2,3-B) Pyridine-5-Carbonitriles are Selective Inhibitors of Plasmodium Falciparum Glycogen Synthase Kinase-3 (Pfgsk-3)
J.Med.Chem., 56, 2013
|
|
2IUJ
 | | Crystal Structure of Soybean Lipoxygenase-B | | Descriptor: | FE (III) ION, LIPOXYGENASE L-5 | | Authors: | Youn, B, Sellhorn, G.E, Mirchel, R.J, Gaffney, B.J, Grimes, H.D, Kang, C. | | Deposit date: | 2006-06-05 | | Release date: | 2006-10-11 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Crystal Structures of Vegetative Soybean Lipoxygenase Vlx-B and Vlx-D, and Comparisons with Seed Isoforms Lox-1 and Lox-3.
Proteins, 65, 2006
|
|
1GZO
 | |
1GZK
 | |
3RRL
 | | Complex structure of 3-oxoadipate coA-transferase subunit A and B from Helicobacter pylori 26695 | | Descriptor: | GLYCEROL, Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A, Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B | | Authors: | Nocek, B, Stein, A, Marshall, N, Jedrzejczak, R, Babnigg, G, Joachimiak, A, Midwest Center for Structural Genomics (MCSG) | | Deposit date: | 2011-04-29 | | Release date: | 2011-06-29 | | Last modified: | 2012-01-11 | | Method: | X-RAY DIFFRACTION (2.29 Å) | | Cite: | Complex structure of 3-oxoadipate coA-transferase subunit A and B
from Helicobacter pylori 26695
TO BE PUBLISHED
|
|
3NY5
 | | Crystal structure of the RBD domain of serine/threonine-protein kinase B-raf from Homo sapiens. Northeast Structural Genomics Consortium Target HR4694F | | Descriptor: | Serine/threonine-protein kinase B-raf | | Authors: | Vorobiev, S, Su, M, Seetharaman, J, Patel, P, Xiao, R, Ciccosanti, C, Shastry, R, Everett, J.K, Nair, R, Acton, T.B, Rost, B, Montelione, G.T, Hunt, J.F, Tong, L, Northeast Structural Genomics Consortium (NESG) | | Deposit date: | 2010-07-14 | | Release date: | 2010-07-28 | | Last modified: | 2017-10-25 | | Method: | X-RAY DIFFRACTION (1.993 Å) | | Cite: | Crystal structure of the RBD domain of serine/threonine-protein kinase B-raf from Homo sapiens.
To be Published
|
|
3DZL
 | | Crystal structure of PhzA/B from Burkholderia cepacia R18194 in complex with (R)-3-oxocyclohexanecarboxylic acid | | Descriptor: | (1R)-3-oxocyclohexanecarboxylic acid, Phenazine biosynthesis protein A/B | | Authors: | Ahuja, E.G, Mentel, M, Graebsch, A, Breinbauer, R, Blankenfeldt, W. | | Deposit date: | 2008-07-30 | | Release date: | 2008-12-30 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (1.75 Å) | | Cite: | PhzA/B Catalyzes the Formation of the Tricycle in Phenazine Biosynthesis.
J.Am.Chem.Soc., 130, 2008
|
|
1H3P
 | | STRUCTURAL CHARACTERISATION OF A MONOCLONAL ANTIBODY SPECIFIC FOR THE PRES1 REGION OF THE HEPATITIS B VIRUS | | Descriptor: | ANTIBODY FAB FRAGMENT | | Authors: | Pizarro, J.C, Vulliez-Le-normand, B, Riottot, M.M, Budkowska, A, Bentley, G.A. | | Deposit date: | 2002-09-12 | | Release date: | 2002-09-19 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural and Functional Characterisation of a Monoclonal Antibody Specific for the Pres1 Region of Hepatitis B Virus
FEBS Lett., 509, 2001
|
|
1KTI
 | | BINDING OF 100 MM N-ACETYL-N'-BETA-D-GLUCOPYRANOSYL UREA TO GLYCOGEN PHOSPHORYLASE B: KINETIC AND CRYSTALLOGRAPHIC STUDIES | | Descriptor: | GLYCOGEN PHOSPHORYLASE, MUSCLE FORM, N-(acetylcarbamoyl)-beta-D-glucopyranosylamine, ... | | Authors: | Oikonomakos, N.G, Kosmopoulou, M, Zographos, S.E, Leonidas, D.D, Chrysina, E.D, Somsak, L, Nagy, V, Praly, J.P, Docsa, T, Toth, B, Gergely, P. | | Deposit date: | 2002-01-16 | | Release date: | 2002-01-30 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (1.97 Å) | | Cite: | Binding of N-acetyl-N'-beta-D-glucopyranosyl urea and N-benzoyl-N'-beta-D-glucopyranosyl urea to glycogen phosphorylase b: kinetic and crystallographic studies.
Eur.J.Biochem., 269, 2002
|
|
4O4U
 | | Crystal structure of the vaccine antigen Transferrin Binding Protein B (TbpB) mutant Trp-176-Ala from Haemophilus parasuis Hp5 | | Descriptor: | GLYCEROL, TbpB | | Authors: | Calmettes, C, Yu, R.H, Schryvers, A.B, Moraes, T.F. | | Deposit date: | 2013-12-19 | | Release date: | 2015-01-14 | | Last modified: | 2015-03-04 | | Method: | X-RAY DIFFRACTION (2.64 Å) | | Cite: | Nonbinding site-directed mutants of transferrin binding protein B exhibit enhanced immunogenicity and protective capabilities.
Infect.Immun., 83, 2015
|
|
1HLF
 | | BINDING OF GLUCOPYRANOSYLIDENE-SPIRO-THIOHYDANTOIN TO GLYCOGEN PHOSPHORYLASE B: KINETIC AND CRYSTALLOGRAPHIC STUD | | Descriptor: | (5S,7R,8S,9S,10R)-8,9,10-trihydroxy-7-(hydroxymethyl)-2-thioxo-6-oxa-1,3-diazaspiro[4.5]decan-4-one, GLYCOGEN PHOSPHORYLASE, PYRIDOXAL-5'-PHOSPHATE | | Authors: | Oikonomakos, N.G, Skamnaki, V.T, Docsa, T, Toth, B, Gergely, P, Osz, E, Szilagyi, L, Somsak, L. | | Deposit date: | 2000-12-01 | | Release date: | 2000-12-13 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (2.26 Å) | | Cite: | Kinetic and crystallographic studies of glucopyranosylidene spirothiohydantoin
binding to glycogen phosphorylase B
BIOORG.MED.CHEM., 10, 2002
|
|
1R7W
 | | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1R7Z
 | | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
4HXW
 | | Pyrrolopyrimidine inhibitors of dna gyrase b and topoisomerase iv, part i: structure guided discovery and optimization of dual targeting agents with potent, broad-spectrum enzymatic activity. | | Descriptor: | (3R)-1-[5-chloro-6-ethyl-2-(pyrido[2,3-b]pyrazin-7-ylsulfanyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl]pyrrolidin-3-amine, DNA gyrase subunit B, TERTIARY-BUTYL ALCOHOL | | Authors: | Bensen, D.C, Trzoss, M, Tari, L.W. | | Deposit date: | 2012-11-12 | | Release date: | 2013-02-13 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.69 Å) | | Cite: | Pyrrolopyrimidine inhibitors of DNA gyrase B (GyrB) and topoisomerase IV (ParE). Part I: Structure guided discovery and optimization of dual targeting agents with potent, broad-spectrum enzymatic activity.
Bioorg.Med.Chem.Lett., 23, 2013
|
|
4HY1
 | | Pyrrolopyrimidine inhibitors of dna gyrase b and topoisomerase iv, part i: structure guided discovery and optimization of dual targeting agents with potent, broad-spectrum enzymatic activity. | | Descriptor: | 6-({4-[(3R)-3-aminopyrrolidin-1-yl]-5-chloro-6-ethyl-7H-pyrrolo[2,3-d]pyrimidin-2-yl}sulfanyl)-1H-isoindol-1-one, Topoisomerase IV, subunit B | | Authors: | Bensen, D.C, Creighton, C.J, Kwan, B, Tari, L.W. | | Deposit date: | 2012-11-12 | | Release date: | 2013-02-13 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Pyrrolopyrimidine inhibitors of DNA gyrase B (GyrB) and topoisomerase IV (ParE). Part I: Structure guided discovery and optimization of dual targeting agents with potent, broad-spectrum enzymatic activity.
Bioorg.Med.Chem.Lett., 23, 2013
|
|
