9F9M
| Crystal structure of MUS81-EME1 bound by compound 21. | Descriptor: | 5-oxidanyl-4-oxidanylidene-1-(4-piperazin-1-ylphenyl)pyridine-3-carboxylic acid, Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, ... | Authors: | Collie, G.W. | Deposit date: | 2024-05-08 | Release date: | 2024-06-19 | Method: | X-RAY DIFFRACTION (2.469 Å) | Cite: | Fragment-Based Discovery of Novel MUS81 Inhibitors Acs Med.Chem.Lett., 2024
|
|
2ZIU
| Crystal structure of the Mus81-Eme1 complex | Descriptor: | Crossover junction endonuclease EME1, Mus81 protein | Authors: | Chang, J.H, Kim, J.J, Choi, J.M, Lee, J.H, Cho, Y. | Deposit date: | 2008-02-25 | Release date: | 2008-04-29 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structure of the Mus81-Eme1 complex Genes Dev., 22, 2008
|
|
2ZIV
| Crystal structure of the Mus81-Eme1 complex | Descriptor: | Crossover junction endonuclease EME1, Mus81 protein | Authors: | Chang, J.H, Kim, J.J, Choi, J.M, Lee, J.H, Cho, Y. | Deposit date: | 2008-02-25 | Release date: | 2008-04-29 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structure of the Mus81-Eme1 complex Genes Dev., 22, 2008
|
|
4P0P
| Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA, and Mg2+ | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
2ZIW
| Crystal structure of the Mus81-Eme1 complex | Descriptor: | Crossover junction endonuclease EME1, Mus81 protein | Authors: | Chang, J.H, Kim, J.J, Choi, J.M, Lee, J.H, Cho, Y. | Deposit date: | 2008-02-25 | Release date: | 2008-04-29 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal structure of the Mus81-Eme1 complex Genes Dev., 22, 2008
|
|
9F99
| Crystal structure of MUS81-EME1 bound by compound 10. | Descriptor: | 2-(4-chlorophenyl)-5-oxidanyl-6-oxidanylidene-1H-pyrimidine-4-carboxylic acid, Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, ... | Authors: | Collie, G.W. | Deposit date: | 2024-05-07 | Release date: | 2024-06-19 | Method: | X-RAY DIFFRACTION (2.803 Å) | Cite: | Fragment-Based Discovery of Novel MUS81 Inhibitors Acs Med.Chem.Lett., 2024
|
|
4P0Q
| Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.851 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
9F9A
| Crystal structure of MUS81-EME1 bound by compound 12. | Descriptor: | 2-naphthalen-2-yl-5-oxidanyl-6-oxidanylidene-1H-pyrimidine-4-carboxylic acid, Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, ... | Authors: | Collie, G.W. | Deposit date: | 2024-05-07 | Release date: | 2024-06-19 | Method: | X-RAY DIFFRACTION (2.911 Å) | Cite: | Fragment-Based Discovery of Novel MUS81 Inhibitors Acs Med.Chem.Lett., 2024
|
|
2ZIX
| Crystal structure of the Mus81-Eme1 complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81 | Authors: | Chang, J.H, Kim, J.J, Choi, J.M, Lee, J.H, Cho, Y. | Deposit date: | 2008-02-25 | Release date: | 2008-04-29 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (3.5 Å) | Cite: | Crystal structure of the Mus81-Eme1 complex Genes Dev., 22, 2008
|
|
4P0S
| human Mus81-Eme1-3'flap DNA complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCT, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (6 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4P0R
| human Mus81-Eme1-3'flap DNA complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (6.501 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|