1FFY
 
 | | INSIGHTS INTO EDITING FROM AN ILE-TRNA SYNTHETASE STRUCTURE WITH TRNA(ILE) AND MUPIROCIN | | Descriptor: | ISOLEUCYL-TRNA, ISOLEUCYL-TRNA SYNTHETASE, MAGNESIUM ION, ... | | Authors: | Silvian, L.F, Wang, J, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-07 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Insights into editing from an ile-tRNA synthetase structure with tRNAile and mupirocin.
Science, 285, 1999
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FG2
 | | CRYSTAL STRUCTURE OF THE LCMV PEPTIDIC EPITOPE GP33 IN COMPLEX WITH THE MURINE CLASS I MHC MOLECULE H-2DB | | Descriptor: | BETA-2 MICROGLOBULIN, H-2 CLASS I HISTOCOMPATIBILITY ANTIGEN, D-B ALPHA CHAIN, ... | | Authors: | Tissot, A.C, Ciatto, C, Mittl, P.R.E, Gruetter, M.G, Plueckthun, A. | | Deposit date: | 2000-07-27 | | Release date: | 2000-10-04 | | Last modified: | 2022-12-21 | | Method: | X-RAY DIFFRACTION (2.754 Å) | | Cite: | Viral escape at the molecular level explained by quantitative T-cell receptor/peptide/MHC interactions and the crystal structure of a peptide/MHC complex.
J.Mol.Biol., 302, 2000
|
|
1FG3
 | | CRYSTAL STRUCTURE OF L-HISTIDINOL PHOSPHATE AMINOTRANSFERASE COMPLEXED WITH L-HISTIDINOL | | Descriptor: | HISTIDINOL PHOSPHATE AMINOTRANSFERASE, PHOSPHORIC ACID MONO-[2-AMINO-3-(3H-IMIDAZOL-4-YL)-PROPYL]ESTER, PYRIDOXAL-5'-PHOSPHATE | | Authors: | Sivaraman, J, Cygler, M. | | Deposit date: | 2000-07-27 | | Release date: | 2001-08-22 | | Last modified: | 2017-10-04 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Crystal structure of histidinol phosphate aminotransferase (HisC) from Escherichia coli, and its covalent complex with pyridoxal-5'-phosphate and l-histidinol phosphate.
J.Mol.Biol., 311, 2001
|
|
1FG4
 | | STRUCTURE OF TRYPAREDOXIN II | | Descriptor: | TRYPAREDOXIN II | | Authors: | Hofmann, B, Budde, H, Bruns, K, Guerrero, S.A, Kalisz, H.M, Menge, U, Montemartini, M, Nogoceke, E, Steinert, P, Wissing, J.B, Flohe, L, Hecht, H.J. | | Deposit date: | 2000-07-28 | | Release date: | 2001-04-25 | | Last modified: | 2017-10-04 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Structures of tryparedoxins revealing interaction with trypanothione.
Biol.Chem., 382, 2001
|
|
1FG5
 | | CRYSTAL STRUCTURE OF BOVINE ALPHA-1,3-GALACTOSYLTRANSFERASE CATALYTIC DOMAIN. | | Descriptor: | N-ACETYLLACTOSAMINIDE ALPHA-1,3-GALACTOSYLTRANSFERASE | | Authors: | Gastinel, L.N, Bignon, C, Shaper, J.H, Joziasse, D.H. | | Deposit date: | 2000-07-28 | | Release date: | 2001-07-28 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Bovine alpha1,3-galactosyltransferase catalytic domain structure and its relationship with ABO histo-blood group and glycosphingolipid glycosyltransferases.
EMBO J., 20, 2001
|
|
1FG6
 | | STRUCTURAL IMPLICATIONS OF DRUG RESISTANT MUTANTS OF HIV-1 PROTEASE: HIGH RESOLUTION CRYSTAL STRUCTURES OF THE MUTANT PROTEASE/SUBSTRATE ANALOG COMPLEXES | | Descriptor: | N-{(2S)-2-[(N-acetyl-L-threonyl-L-isoleucyl)amino]hexyl}-L-norleucyl-L-glutaminyl-N~5~-[amino(iminio)methyl]-L-ornithinamide, PROTEASE RETROPEPSIN | | Authors: | Mahalingam, B, Louis, J.M, Harrison, R.W, Weber, I.T. | | Deposit date: | 2000-07-25 | | Release date: | 2001-06-01 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Structural implications of drug-resistant mutants of HIV-1 protease: high-resolution crystal structures of the mutant protease/substrate analogue complexes.
Proteins, 43, 2001
|
|
1FG7
 | |
1FG8
 | | STRUCTURAL IMPLICATIONS OF DRUG RESISTANT MUTANTS OF HIV-1 PROTEASE: HIGH RESOLUTION CRYSTAL STRUCTURES OF THE MUTANT PROTEASE/SUBSTRATE ANALOG COMPLEXES | | Descriptor: | N-[(2R)-2-({N~5~-[amino(iminio)methyl]-L-ornithyl-L-valyl}amino)-4-methylpentyl]-L-phenylalanyl-L-alpha-glutamyl-L-alanyl-L-norleucinamide, PROTEASE RETROPEPSIN | | Authors: | Mahalingam, B, Louis, J.M, Harrison, R.W, Weber, I.T. | | Deposit date: | 2000-07-25 | | Release date: | 2001-06-01 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Structural implications of drug-resistant mutants of HIV-1 protease: high-resolution crystal structures of the mutant protease/substrate analogue complexes.
Proteins, 43, 2001
|
|
1FG9
 | | 3:1 COMPLEX OF INTERFERON-GAMMA RECEPTOR WITH INTERFERON-GAMMA DIMER | | Descriptor: | INTERFERON GAMMA, INTERFERON-GAMMA RECEPTOR ALPHA CHAIN | | Authors: | Thiel, D.J, le Du, M.-H, Walter, R.L, D'Arcy, A, Chene, C, Fountoulakis, M, Garotta, G, Winkler, F.K, Ealick, S.E. | | Deposit date: | 2000-07-28 | | Release date: | 2000-08-11 | | Last modified: | 2022-12-21 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex.
Structure Fold.Des., 8, 2000
|
|
1FGA
 | |
1FGB
 | | TOXIN | | Descriptor: | CHOLERA TOXIN B SUBUNIT PENTAMER | | Authors: | Zhang, R.-G, Westbrook, E. | | Deposit date: | 1996-02-21 | | Release date: | 1996-12-23 | | Last modified: | 2024-06-05 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The 2.4 A crystal structure of cholera toxin B subunit pentamer: choleragenoid.
J.Mol.Biol., 251, 1995
|
|
1FGC
 | | STRUCTURAL IMPLICATIONS OF DRUG RESISTANT MUTANTS OF HIV-1 PROTEASE: HIGH RESOLUTION CRYSTAL STRUCTURES OF THE MUTANT PROTEASE/SUBSTRATE ANALOG COMPLEXES | | Descriptor: | N-{(2S)-2-[(N-acetyl-L-threonyl-L-isoleucyl)amino]hexyl}-L-norleucyl-L-glutaminyl-N~5~-[amino(iminio)methyl]-L-ornithinamide, PROTEASE RETROPEPSIN | | Authors: | Mahalingam, B, Louis, J.M, Harrison, R.W, Weber, I.T. | | Deposit date: | 2000-07-28 | | Release date: | 2001-06-01 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Structural implications of drug-resistant mutants of HIV-1 protease: high-resolution crystal structures of the mutant protease/substrate analogue complexes.
Proteins, 43, 2001
|
|
1FGD
 | |
1FGE
 | |
1FGG
 | | CRYSTAL STRUCTURE OF 1,3-GLUCURONYLTRANSFERASE I (GLCAT-I) COMPLEXED WITH GAL-GAL-XYL, UDP, AND MN2+ | | Descriptor: | GLUCURONYLTRANSFERASE I, MANGANESE (II) ION, UNKNOWN ATOM OR ION, ... | | Authors: | Pedersen, L.C, Tsuchida, K, Kitagawa, H, Sugahara, K, Darden, T.A. | | Deposit date: | 2000-07-28 | | Release date: | 2001-01-31 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Heparan/chondroitin sulfate biosynthesis. Structure and mechanism of human glucuronyltransferase I.
J.Biol.Chem., 275, 2000
|
|
1FGH
 | | COMPLEX WITH 4-HYDROXY-TRANS-ACONITATE | | Descriptor: | 4-HYDROXY-ACONITATE ION, ACONITASE, IRON/SULFUR CLUSTER | | Authors: | Lauble, H, Kennedy, M.C, Emptage, M.H, Beinert, H, Stout, C.D. | | Deposit date: | 1996-09-14 | | Release date: | 1996-12-23 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | The reaction of fluorocitrate with aconitase and the crystal structure of the enzyme-inhibitor complex.
Proc.Natl.Acad.Sci.USA, 93, 1996
|
|
1FGI
 | |
1FGJ
 | | X-RAY STRUCTURE OF HYDROXYLAMINE OXIDOREDUCTASE | | Descriptor: | HEME C, HYDROXYLAMINE OXIDOREDUCTASE, PROTOPORPHYRIN IX CONTAINING FE | | Authors: | Tanaka, N, Igarashi, N, Moriyama, H. | | Deposit date: | 1997-03-03 | | Release date: | 1998-03-04 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | The 2.8 A structure of hydroxylamine oxidoreductase from a nitrifying chemoautotrophic bacterium, Nitrosomonas europaea.
Nat.Struct.Biol., 4, 1997
|
|
1FGK
 | |
1FGL
 | | Cyclophilin A complexed with a fragment of HIV-1 GAG protein | | Descriptor: | CYCLOPHILIN A, HIV-1 GAG PROTEIN | | Authors: | Zhao, Y, Chen, Y, Schutkowski, M, Fischer, G, Ke, H. | | Deposit date: | 1996-11-18 | | Release date: | 1997-04-01 | | Last modified: | 2017-11-29 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Cyclophilin A complexed with a fragment of HIV-1 gag protein: insights into HIV-1 infectious activity.
Structure, 5, 1997
|
|
1FGM
 | |
1FGN
 | | MONOCLONAL MURINE ANTIBODY 5G9-ANTI-HUMAN TISSUE FACTOR | | Descriptor: | IMMUNOGLOBULIN FAB 5G9 | | Authors: | Huang, M, Syed, R, Stura, E.A, Stone, M.J, Stefanko, R.S, Ruf, W, Edgington, T.S, Wilson, I.A. | | Deposit date: | 1997-04-10 | | Release date: | 1998-02-25 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | The mechanism of an inhibitory antibody on TF-initiated blood coagulation revealed by the crystal structures of human tissue factor, Fab 5G9 and TF.5G9 complex.
J.Mol.Biol., 275, 1998
|
|
1FGO
 | |
