6M0J
 
 | | Crystal structure of SARS-CoV-2 spike receptor-binding domain bound with ACE2 | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, Angiotensin-converting enzyme 2, CHLORIDE ION, ... | | Authors: | Wang, X, Lan, J, Ge, J, Yu, J, Shan, S. | | Deposit date: | 2020-02-21 | | Release date: | 2020-03-18 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.45 Å) | | Cite: | Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor.
Nature, 581, 2020
|
|
3B5X
 | | Crystal Structure of MsbA from Vibrio cholerae | | Descriptor: | Lipid A export ATP-binding/permease protein msbA | | Authors: | Ward, A, Reyes, C.L, Yu, J, Roth, C.B, Chang, G. | | Deposit date: | 2007-10-26 | | Release date: | 2007-12-04 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (5.5 Å) | | Cite: | Flexibility in the ABC transporter MsbA: Alternating access with a twist.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
3B5Z
 | | Crystal Structure of MsbA from Salmonella typhimurium with ADP Vanadate | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, Lipid A export ATP-binding/permease protein msbA, VANADATE ION | | Authors: | Ward, A, Reyes, C.L, Yu, J, Roth, C.B, Chang, G. | | Deposit date: | 2007-10-26 | | Release date: | 2007-12-04 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (4.2 Å) | | Cite: | Flexibility in the ABC transporter MsbA: Alternating access with a twist.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
3B5W
 | | Crystal Structure of Eschericia coli MsbA | | Descriptor: | Lipid A export ATP-binding/permease protein msbA | | Authors: | Ward, A, Reyes, C.L, Yu, J, Roth, C.B, Chang, G. | | Deposit date: | 2007-10-26 | | Release date: | 2007-12-04 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (5.3 Å) | | Cite: | Flexibility in the ABC transporter MsbA: Alternating access with a twist.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
3B60
 | | Crystal Structure of MsbA from Salmonella typhimurium with AMPPNP, higher resolution form | | Descriptor: | Lipid A export ATP-binding/permease protein msbA, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER | | Authors: | Ward, A, Reyes, C.L, Yu, J, Roth, C.B, Chang, G. | | Deposit date: | 2007-10-26 | | Release date: | 2007-12-04 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3.7 Å) | | Cite: | Flexibility in the ABC transporter MsbA: Alternating access with a twist.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
3B5Y
 | | Crystal Structure of MsbA from Salmonella typhimurium with AMPPNP | | Descriptor: | Lipid A export ATP-binding/permease protein msbA, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER | | Authors: | Ward, A, Reyes, C.L, Yu, J, Roth, C.B, Chang, G. | | Deposit date: | 2007-10-26 | | Release date: | 2007-12-04 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (4.5 Å) | | Cite: | Flexibility in the ABC transporter MsbA: Alternating access with a twist.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
7QE7
 | | High-resolution structure of the Anaphase-promoting complex/cyclosome (APC/C) bound to co-activator Cdh1 | | Descriptor: | Anaphase-promoting complex subunit 1, Anaphase-promoting complex subunit 10, Anaphase-promoting complex subunit 11, ... | | Authors: | Hoefler, A, Yu, J, Chang, L, Zhang, Z, Yang, J, Boland, A, Barford, D. | | Deposit date: | 2021-12-01 | | Release date: | 2022-01-26 | | Last modified: | 2024-05-22 | | Method: | ELECTRON MICROSCOPY (2.9 Å) | | Cite: | High-resolution structure of the Anaphase-promoting complex (APC/C) bound to co-activator Cdh1
To Be Published
|
|
5ZUE
 | | GTP-bound, double-stranded, curved FtsZ protofilament structure | | Descriptor: | Cell division protein FtsZ, GUANOSINE-5'-TRIPHOSPHATE | | Authors: | Guan, F, Yu, J, Yu, J, Liu, Y, Li, Y, Feng, X.H, Huang, K.C, Chang, Z, Ye, S. | | Deposit date: | 2018-05-07 | | Release date: | 2018-07-04 | | Last modified: | 2024-03-27 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Lateral interactions between protofilaments of the bacterial tubulin homolog FtsZ are essential for cell division
Elife, 7, 2018
|
|
4DSQ
 | | Crystal structure of peroxiredoxin Ahp1 from Saccharomyces cerevisiae in oxidized form | | Descriptor: | Peroxiredoxin type-2 | | Authors: | Lian, F.M, Yu, J, Ma, X.X, Yu, X.J, Chen, Y, Zhou, C.Z. | | Deposit date: | 2012-02-19 | | Release date: | 2012-04-11 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structural Snapshots of Yeast Alkyl Hydroperoxide Reductase Ahp1 Peroxiredoxin Reveal a Novel Two-cysteine Mechanism of Electron Transfer to Eliminate Reactive Oxygen Species
J.Biol.Chem., 287, 2012
|
|
4DSS
 | | Crystal structure of peroxiredoxin Ahp1 from Saccharomyces cerevisiae in complex with thioredoxin Trx2 | | Descriptor: | Peroxiredoxin type-2, Thioredoxin-2 | | Authors: | Lian, F.M, Yu, J, Ma, X.X, Yu, X.J, Chen, Y, Zhou, C.Z. | | Deposit date: | 2012-02-19 | | Release date: | 2012-04-11 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Structural Snapshots of Yeast Alkyl Hydroperoxide Reductase Ahp1 Peroxiredoxin Reveal a Novel Two-cysteine Mechanism of Electron Transfer to Eliminate Reactive Oxygen Species.
J.Biol.Chem., 287, 2012
|
|
4DSR
 | | Crystal structure of peroxiredoxin Ahp1 from Saccharomyces cerevisiae in reduced form | | Descriptor: | Peroxiredoxin type-2 | | Authors: | Lian, F.M, Yu, J, Ma, X.X, Yu, X.J, Chen, Y, Zhou, C.Z. | | Deposit date: | 2012-02-19 | | Release date: | 2012-04-11 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.91 Å) | | Cite: | Structural Snapshots of Yeast Alkyl Hydroperoxide Reductase Ahp1 Peroxiredoxin Reveal a Novel Two-cysteine Mechanism of Electron Transfer to Eliminate Reactive Oxygen Species.
J.Biol.Chem., 287, 2012
|
|
3GX8
 | | Structural and biochemical characterization of yeast monothiol glutaredoxin Grx5 | | Descriptor: | Monothiol glutaredoxin-5, mitochondrial, SULFATE ION | | Authors: | Wang, Y, He, Y.X, Yu, J, Xiong, Y, Chen, Y, Zhou, C.Z. | | Deposit date: | 2009-04-01 | | Release date: | 2010-04-14 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (1.673 Å) | | Cite: | Structural and biochemical characterization of yeast monothiol glutaredoxin Grx5
To be Published
|
|
2M80
 | | Solution structure of yeast dithiol glutaredoxin Grx8 | | Descriptor: | Glutaredoxin-8 | | Authors: | Tang, Y, Zhang, J, Yu, J, Wu, J, Zhou, C.Z, Shi, Y. | | Deposit date: | 2013-05-02 | | Release date: | 2014-05-07 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Structure-guided activity enhancement and catalytic mechanism of yeast grx8
Biochemistry, 53, 2014
|
|
5Y56
 | | Fc mutant (K392D/K409D/D399K) | | Descriptor: | Immunoglobulin gamma-1 heavy chain, beta-D-galactopyranose-(1-4)-2-acetamido-2-deoxy-alpha-D-glucopyranose-(1-2)-alpha-D-mannopyranose-(1-6)-[2-acetamido-2-deoxy-beta-D-glucopyranose-(1-2)-beta-D-mannopyranose-(1-3)]beta-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-[beta-L-fucopyranose-(1-6)]2-acetamido-2-deoxy-beta-D-glucopyranose, beta-D-galactopyranose-(1-4)-2-acetamido-2-deoxy-alpha-D-glucopyranose-(1-2)-alpha-D-mannopyranose-(1-6)-[beta-D-mannopyranose-(1-3)]beta-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose | | Authors: | Ye, S, Xu, T, Yu, J, Wang, X, Xu, T, Jin, Q, Duan, J, Wu, J, Wu, H. | | Deposit date: | 2017-08-07 | | Release date: | 2017-09-13 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.653 Å) | | Cite: | A rational approach to enhancing antibody Fc homodimer formation for robust production of antibody mixture in a single cell line
J. Biol. Chem., 292, 2017
|
|
1R7Z
 | | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1TXS
 | | STEM-LOOP D OF THE CLOVERLEAF DOMAIN OF ENTEROVIRAL 5'UTR RNA | | Descriptor: | Enteroviral 5'-UTR | | Authors: | Du, Z, Yu, J, Ulyanov, N.B, Andino, R, James, T.L. | | Deposit date: | 2004-07-06 | | Release date: | 2004-10-05 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Solution Structure of a Consensus Stem-Loop D RNA Domain that Plays Important Roles in Regulating Translation and Replication in Enteroviruses and Rhinoviruses
Biochemistry, 43, 2004
|
|
5AXM
 | | Crystal structure of Thg1 like protein (TLP) with tRNA(Phe) | | Descriptor: | MAGNESIUM ION, RNA (75-MER), tRNA(His)-5'-guanylyltransferase (Thg1) like protein | | Authors: | Kimura, S, Suzuki, T, Yu, J, Kato, K, Yao, M. | | Deposit date: | 2015-07-31 | | Release date: | 2016-08-03 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.21 Å) | | Cite: | Template-dependent nucleotide addition in the reverse (3'-5') direction by Thg1-like protein
Sci Adv, 2, 2016
|
|
5AXL
 | | Crystal structure of Thg1 like protein (TLP) with GTP | | Descriptor: | GUANOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION, tRNA(His)-5'-guanylyltransferase (Thg1) like protein | | Authors: | Kimura, S, Suzuki, T, Yu, J, Kato, K, Yao, M. | | Deposit date: | 2015-07-31 | | Release date: | 2016-08-03 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.998 Å) | | Cite: | Template-dependent nucleotide addition in the reverse (3'-5') direction by Thg1-like protein
Sci Adv, 2, 2016
|
|
5AXK
 | | Crystal structure of Thg1 like protein (TLP) | | Descriptor: | GLYCEROL, tRNA(His)-5'-guanylyltransferase (Thg1) like protein | | Authors: | Kimura, S, Suzuki, T, Yu, J, Kato, K, Yao, M. | | Deposit date: | 2015-07-31 | | Release date: | 2016-08-03 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.29 Å) | | Cite: | Template-dependent nucleotide addition in the reverse (3'-5') direction by Thg1-like protein
Sci Adv, 2, 2016
|
|
5AXN
 | | Crystal structure of Thg1 like protein (TLP) with tRNA(Phe) and GDPNP | | Descriptor: | MAGNESIUM ION, PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER, RNA (75-MER), ... | | Authors: | Kimura, S, Suzuki, T, Yu, J, Kato, K, Yao, M. | | Deposit date: | 2015-07-31 | | Release date: | 2016-08-03 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.703 Å) | | Cite: | Template-dependent nucleotide addition in the reverse (3'-5') direction by Thg1-like protein
Sci Adv, 2, 2016
|
|
1R7W
 | | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1ROQ
 | |
5Y4O
 | | Cryo-EM structure of MscS channel, YnaI | | Descriptor: | Low conductance mechanosensitive channel YnaI | | Authors: | Zhang, Y, Yu, J. | | Deposit date: | 2017-08-04 | | Release date: | 2019-03-20 | | Method: | ELECTRON MICROSCOPY (3.8 Å) | | Cite: | A binding-block ion selective mechanism revealed by a Na/K selective channel.
Protein Cell, 9, 2018
|
|
3L9Y
 | | Crystal structures of holo and Cu-deficient Cu/ZnSOD from the silkworm Bombyx mori and the implications in Amyotrophic lateral sclerosis | | Descriptor: | COPPER (II) ION, Superoxide dismutase [Cu-Zn], ZINC ION | | Authors: | Zhang, N.-N, He, Y.-X, Li, W.-F, Zhao, F, Yan, L.-F, Zhang, G.-Z, Teng, Y.-B, Yu, J, Chen, Y, Zhou, C.-Z. | | Deposit date: | 2010-01-06 | | Release date: | 2010-03-23 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Crystal structures of holo and Cu-deficient Cu/Zn-SOD from the silkworm Bombyx mori and the implications in amyotrophic lateral sclerosis.
Proteins, 78, 2010
|
|
3L9E
 | | Crystal structures of holo and Cu-deficient Cu/ZnSOD from the silkworm Bombyx mori and the implications in Amyotrophic lateral sclerosis | | Descriptor: | Superoxide dismutase [Cu-Zn], ZINC ION | | Authors: | Zhang, N.-N, He, Y.-X, Li, W.-F, Zhao, F, Yan, L.-F, Zhang, G.-Z, Teng, Y.-B, Yu, J, Chen, Y, Zhou, C.-Z. | | Deposit date: | 2010-01-05 | | Release date: | 2010-03-31 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | Crystal structures of holo and Cu-deficient Cu/Zn-SOD from the silkworm Bombyx mori and the implications in amyotrophic lateral sclerosis
Proteins, 78, 2010
|
|
