8FMS
| |
8FMR
| |
8FMT
| |
5LE3
| Crystal structure of DARPin-DARPin rigid fusion, variant DD_D12_09_D12 | Descriptor: | DD_D12_09_D12 | Authors: | Batyuk, A, Wu, Y, Mittl, P.R, Plueckthun, A. | Deposit date: | 2016-06-29 | Release date: | 2017-08-02 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.5 Å) | Cite: | Rigidly connected multispecific artificial binders with adjustable geometries. Sci Rep, 7, 2017
|
|
4OGI
| Crystal Structure of the first bromodomain of human BRD4 in complex with the inhibitor BI-2536 | Descriptor: | 1,2-ETHANEDIOL, 4-{[(7R)-8-cyclopentyl-7-ethyl-5-methyl-6-oxo-5,6,7,8-tetrahydropteridin-2-yl]amino}-3-methoxy-N-(1-methylpiperidin-4-yl)benzamide, Bromodomain-containing protein 4 | Authors: | Filippakopoulos, P, Picaud, S, Jose, B, Martin, S, Fedorov, O, von Delft, F, Arrowsmith, C.H, Edwards, A.M, Bountra, C, Knapp, S, Structural Genomics Consortium (SGC) | Deposit date: | 2014-01-16 | Release date: | 2014-02-26 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (1.73 Å) | Cite: | Dual kinase-bromodomain inhibitors for rationally designed polypharmacology. Nat.Chem.Biol., 10, 2014
|
|
6SP4
| KEAP1 IN COMPLEX WITH COMPOUND 23 | Descriptor: | (1~{S},2~{R})-2-[[(1~{S})-1-[[1,3-bis(oxidanylidene)isoindol-2-yl]methyl]-5-(2-hydroxyethyloxy)-3,4-dihydro-1~{H}-isoquinolin-2-yl]carbonyl]cyclobutane-1-carboxamide, Kelch-like ECH-associated protein 1 | Authors: | Ontoria, J.M, Biancofiore, I, Fezzardi, P, Torrente de Haro, E, Colarusso, S, Bianchi, E, Andreini, M, Patsilinakos, A, Summa, V, Pacifici, R, Munoz-Sanjuan, I, Park, L, Bresciani, A, Dominguez, C, Toledo-Sherman, L, Harper, S. | Deposit date: | 2019-08-30 | Release date: | 2020-06-03 | Method: | X-RAY DIFFRACTION (2.59 Å) | Cite: | Combined Peptide and Small-Molecule Approach toward Nonacidic THIQ Inhibitors of the KEAP1/NRF2 Interaction. Acs Med.Chem.Lett., 11, 2020
|
|
6BID
| 1.15 A resolution structure of Norovirus 3CL protease in complex with a triazole-based macrocyclic inhibitor | Descriptor: | 3C-like protease, benzyl [(8S,11S,14S)-11-(cyclohexylmethyl)-8-(hydroxymethyl)-5,10,13-trioxo-1,4,9,12,17,18-hexaazabicyclo[14.2.1]nonadeca-16(19),17-dien-14-yl]carbamate | Authors: | Lovell, S, Battaile, K.P, Mehzabeen, N, Kankanamalage, A.C.G, Weerawarna, P.M, Rathnayake, A.D, Kim, Y, Chang, K.O, Groutas, W.C. | Deposit date: | 2017-11-01 | Release date: | 2018-11-07 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (1.15 Å) | Cite: | Putative structural rearrangements associated with the interaction of macrocyclic inhibitors with norovirus 3CL protease. Proteins, 87, 2019
|
|
8OKL
| Crystal structure of F2F-2020185-01X bound to the main protease (3CLpro/Mpro) of SARS-CoV-2. | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 1,2-ETHANEDIOL, 3C-like proteinase nsp5, ... | Authors: | Costanzi, E, Demitri, N, Storici, P. | Deposit date: | 2023-03-28 | Release date: | 2023-05-03 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Broad-spectrum coronavirus 3C-like protease peptidomimetic inhibitors effectively block SARS-CoV-2 replication in cells: Design, synthesis, biological evaluation, and X-ray structure determination. Eur.J.Med.Chem., 253, 2023
|
|
5E08
| Specific Recognition of a Single-stranded RNA Sequence by an Engineered Synthetic Antibody Fragment | Descriptor: | Fab Heavy Chain, Fab Light Chain, RNA | Authors: | Huang, H, Qin, D, Li, N, Shao, Y, Staley, J.P, Kossiakoff, A.A, Koide, S, Piccirilli, J.A. | Deposit date: | 2015-09-28 | Release date: | 2016-09-21 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.38 Å) | Cite: | Specific Recognition of a Single-Stranded RNA Sequence by a Synthetic Antibody Fragment. J.Mol.Biol., 428, 2016
|
|
5LH8
| Trypsin inhibitors for the treatment of pancreatitis - cpd 8 | Descriptor: | (2~{S},4~{S})-1-[4-(aminomethyl)-3-methoxy-phenyl]carbonyl-4-(4-cyclopropyl-1,2,3-triazol-1-yl)-~{N}-[(1~{S},2~{R})-2-phenylcyclohexyl]pyrrolidine-2-carboxamide, CALCIUM ION, Cationic trypsin, ... | Authors: | Schiering, N, D'Arcy, A, Skaanderup, P, Simic, O, Brandl, T, Woelcke, J. | Deposit date: | 2016-07-08 | Release date: | 2016-08-10 | Last modified: | 2019-10-16 | Method: | X-RAY DIFFRACTION (1.54 Å) | Cite: | Trypsin inhibitors for the treatment of pancreatitis. Bioorg.Med.Chem.Lett., 26, 2016
|
|
1OC1
| ISOPENICILLIN N SYNTHASE aminoadipoyl-cysteinyl-aminobutyrate-FE COMPLEX | Descriptor: | DELTA-(L-ALPHA-AMINOADIPOYL)-L-CYSTEINYL-D-VINYLGLYCINE, FE (II) ION, ISOPENICILLIN N SYNTHETASE, ... | Authors: | Long, A.J, Clifton, I.J, Roach, P.L, Baldwin, J.E, Schofield, C.J, Rutledge, P.J. | Deposit date: | 2003-02-03 | Release date: | 2004-02-02 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Structural Studies on the Reaction of Isopenicillin N Synthase with the Substrate Analogue Delta-(L-Alpha-Aminoadipoyl)-L-Cysteinyl-D-Alpha-Aminobutyrate Biochem.J., 372, 2003
|
|
8FOU
| Structure of Agrobacterium tumefaciens bacteriophage Milano contracted tail-tube | Descriptor: | Virion-associated protein | Authors: | Sonani, R.R, Leiman, P.G, Wang, F, Kreutzberger, M.A.B, Sebastian, A, Esteves, N.C, Kelly, R.J, Scharf, B, Egelman, E.H. | Deposit date: | 2023-01-03 | Release date: | 2024-01-17 | Last modified: | 2024-02-07 | Method: | ELECTRON MICROSCOPY (3.3 Å) | Cite: | An extensive disulfide bond network prevents tail contraction in Agrobacterium tumefaciens phage Milano. Nat Commun, 15, 2024
|
|
6FUR
| |
8DYZ
| |
8FOY
| Structure of Agrobacterium tumefaciens bacteriophage Milano contracted tail-sheath | Descriptor: | Tail sheath protein | Authors: | Sonani, R.R, Leiman, P.G, Wang, F, Kreutzberger, M.A.B, Sebastian, A, Esteves, N.C, Kelly, R.J, Scharf, B, Egelman, E.H. | Deposit date: | 2023-01-03 | Release date: | 2024-01-17 | Last modified: | 2024-02-07 | Method: | ELECTRON MICROSCOPY (2.9 Å) | Cite: | An extensive disulfide bond network prevents tail contraction in Agrobacterium tumefaciens phage Milano. Nat Commun, 15, 2024
|
|
5LIJ
| polyalanine chain built in bacteriophage phi812K1-420 cement protein density map | Descriptor: | polyalanine chain built in bacteriophage phi812K1-420 cement protein density map | Authors: | Novacek, J, Siborova, M, Benesik, M, Pantucek, R, Doskar, J, Plevka, P. | Deposit date: | 2016-07-14 | Release date: | 2017-07-26 | Last modified: | 2024-05-15 | Method: | ELECTRON MICROSCOPY (4.2 Å) | Cite: | Structure and genome release of Twort-like Myoviridae phage with a double-layered baseplate. Proc. Natl. Acad. Sci. U.S.A., 113, 2016
|
|
8DZ7
| |
5LVU
| XiaF (apo) from Streptomyces sp. | Descriptor: | SULFATE ION, XiaF protein | Authors: | Kugel, S, Baunach, M, Baer, P, Ishida-Ito, M, Sundaram, S, Xu, Z, Groll, M, Hertweck, C. | Deposit date: | 2016-09-14 | Release date: | 2017-06-28 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Cryptic indole hydroxylation by a non-canonical terpenoid cyclase parallels bacterial xenobiotic detoxification. Nat Commun, 8, 2017
|
|
8OKN
| Crystal structure of F2F-2020198-00X bound to the main protease (3CLpro/Mpro) of SARS-CoV-2. | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 1,2-ETHANEDIOL, 3C-like proteinase nsp5, ... | Authors: | Costanzi, E, Demitri, N, Storici, P. | Deposit date: | 2023-03-28 | Release date: | 2023-05-03 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (1.35 Å) | Cite: | Broad-spectrum coronavirus 3C-like protease peptidomimetic inhibitors effectively block SARS-CoV-2 replication in cells: Design, synthesis, biological evaluation, and X-ray structure determination. Eur.J.Med.Chem., 253, 2023
|
|
6FZB
| AadA in complex with ATP, magnesium and streptomycin | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, CHLORIDE ION, DI(HYDROXYETHYL)ETHER, ... | Authors: | Kanchugal P, S, Selmer, M. | Deposit date: | 2018-03-14 | Release date: | 2018-06-13 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (2.05 Å) | Cite: | Structural mechanism of AadA, a dual-specificity aminoglycoside adenylyltransferase fromSalmonella enterica. J. Biol. Chem., 293, 2018
|
|
5ZCY
| |
2XSW
| Crystal structure of human INPP5E | Descriptor: | 72 KDA INOSITOL POLYPHOSPHATE 5-PHOSPHATASE, CHLORIDE ION, GLYCEROL | Authors: | Tresaugues, L, Schutz, P, Arrowsmith, C.H, Berglund, H, Bountra, C, Collins, R, Edwards, A.M, Flodin, S, Flores, A, Graslund, S, Hammarstrom, M, Johansson, I, Karlberg, T, Kol, S, Kotenyova, T, Kouznetsova, E, Moche, M, Nyman, T, Persson, C, Schuler, H, Schutz, P, Siponen, M.I, Thorsell, A.G, Van Der Berg, S, Wahlberg, E, Weigelt, J, Welin, M, Nordlund, P. | Deposit date: | 2010-09-30 | Release date: | 2010-11-17 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Crystal Structure of Human Inpp5E To be Published
|
|
2Y1K
| STRUCTURE OF HUMAN BUTYRYLCHOLINESTERASE INHIBITED BY CBDP (12H SOAK): PHOSPHOSERINE ADDUCT | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, CHLORIDE ION, CHOLINESTERASE, ... | Authors: | Carletti, E, Colletier, J.P, Nachon, F, Weik, M. | Deposit date: | 2010-12-08 | Release date: | 2011-06-29 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Reaction of Cresyl Saligenin Phosphate, the Organophosphorus Agent Implicated in Aerotoxic Syndrome, with Human Cholinesterases: Mechanistic Studies Employing Kinetics, Mass Spectrometry, and X-Ray Structure Analysis. Chem.Res.Toxicol., 24, 2011
|
|
5E3M
| Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | Descriptor: | DNA (27-MER), DNA-binding protein Fis | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2015-10-03 | Release date: | 2016-03-09 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (2.886 Å) | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, 2016
|
|
5AP0
| Naturally Occurring Mutations in the MPS1 Gene Predispose Cells to Kinase Inhibitor Drug Resistance. | Descriptor: | 1,2-ETHANEDIOL, 9-CYCLOPENTYL-2-[[2-METHOXY-4-[(1-METHYLPIPERIDIN-4-YL)OXY]-PHENYL]AMINO]-7-METHYL-7,9-DIHYDRO-8H-PURIN-8-ONE, DIMETHYL SULFOXIDE, ... | Authors: | Gurden, M.D, Westwood, I.M, Faisal, A, Naud, S, Cheung, K.J, McAndrew, C, Wood, A, Schmitt, J, Boxall, K, Mak, G, Workman, P, Burke, R, Hoelder, S, Blagg, J, van Montfort, R.L.M, Linardopoulos, S. | Deposit date: | 2015-09-14 | Release date: | 2015-09-23 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.15 Å) | Cite: | Naturally Occurring Mutations in the Mps1 Gene Predispose Cells to Kinase Inhibitor Drug Resistance. Cancer Res., 75, 2015
|
|