Loading
PDBj
MenuPDBj@FacebookPDBj@TwitterPDBj@YouTubewwPDB FoundationwwPDB
RCSB PDBPDBeBMRBAdv. SearchSearch help
PDB: 45712 results

7H1S
DownloadVisualize
BU of 7h1s by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with Z57477251
Descriptor: 4-(piperazin-1-yl)quinoline, DIMETHYL SULFOXIDE, Serine protease NS3, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.376 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
7H2B
DownloadVisualize
BU of 7h2b by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with Z1272517105
Descriptor: DIMETHYL SULFOXIDE, Serine protease NS3, Serine protease subunit NS2B, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.602 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
7H2S
DownloadVisualize
BU of 7h2s by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with Z396117078
Descriptor: DIMETHYL SULFOXIDE, N-(1-methyl-1H-pyrazol-4-yl)-2-(trifluoromethyl)benzamide, Serine protease NS3, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.57 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
7H27
DownloadVisualize
BU of 7h27 by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with Z1203191681
Descriptor: DIMETHYL SULFOXIDE, N-[(1H-imidazol-2-yl)methyl]acetamide, Serine protease NS3, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.351 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
7H1M
DownloadVisualize
BU of 7h1m by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with POB0075
Descriptor: 1-[1-(pyridin-2-yl)cyclopentyl]methanamine, DIMETHYL SULFOXIDE, Serine protease NS3, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.609 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
7H2P
DownloadVisualize
BU of 7h2p by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with Z2509342103
Descriptor: (8S)-3-methyl-4,5,6,7-tetrahydropyrazolo[1,5-a]pyrazine, DIMETHYL SULFOXIDE, Serine protease NS3, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.452 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
7H26
DownloadVisualize
BU of 7h26 by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with Z1198317053
Descriptor: (5-methyl-1H-pyrazolo[3,4-b]pyridin-1-yl)acetic acid, DIMETHYL SULFOXIDE, SULFATE ION, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.849 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
6KSH
DownloadVisualize
BU of 6ksh by Molmil
Crystal structure of pyruvate kinase (PYK) from Plasmodium falciparum in complex with oxalate and ATP
Descriptor: ADENOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION, OXALATE ION, ...
Authors:Zhong, W, Cai, Q, Li, K, Lescar, J, Dedon, P.C.
Deposit date:2019-08-23
Release date:2020-08-26
Last modified:2023-11-22
Method:X-RAY DIFFRACTION (2.6 Å)
Cite:Pyruvate kinase from Plasmodium falciparum: Structural and kinetic insights into the allosteric mechanism.
Biochem.Biophys.Res.Commun., 532, 2020
7H1T
DownloadVisualize
BU of 7h1t by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with Z362020366
Descriptor: DIMETHYL SULFOXIDE, Serine protease NS3, Serine protease subunit NS2B, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.419 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
7H2G
DownloadVisualize
BU of 7h2g by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with Z1509195674
Descriptor: 4-[(3S)-piperidin-3-yl]-1H-indole, DIMETHYL SULFOXIDE, Serine protease NS3, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.25 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
7H21
DownloadVisualize
BU of 7h21 by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with Z1269221363
Descriptor: 3-ethenyl-1-methyl-pyridine, DIMETHYL SULFOXIDE, Serine protease NS3, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.462 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
7H0K
DownloadVisualize
BU of 7h0k by Molmil
Crystal structure of SARS-CoV-2 NSP3 Macrodomain in complex with ASAP-0011076-001
Descriptor: 4-{[(1S)-1-(1,1-dioxo-1,2,3,4-tetrahydro-1lambda~6~,2-benzothiazin-7-yl)-2-methylpropyl]amino}-N-ethyl-7H-pyrrolo[2,3-d]pyrimidine-6-carboxamide, Papain-like protease nsp3
Authors:Aschenbrenner, J.C, Fearon, D, Tomlinson, C.W.E, Marples, P.G, Fairhead, M, Balcomb, B.H, Chandran, A.V, Godoy, A.S, Koekemoer, L, Lithgo, R.M, Ni, X, Thompson, W, Wang, S, Wild, C, Williams, E.P, Winokan, M, Walsh, M.A, von Delft, F.
Deposit date:2024-01-23
Release date:2024-05-15
Method:X-RAY DIFFRACTION (1.3 Å)
Cite:Group deposition of SARS-CoV-2 NSP3 Macrodomain in complex with inhibitors from the ASAP AViDD centre
To Be Published
7H2J
DownloadVisualize
BU of 7h2j by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with Z1787627869
Descriptor: 5-chloro-N-methyl-N-{[(3R)-oxolan-3-yl]methyl}pyrimidin-4-amine, DIMETHYL SULFOXIDE, Serine protease NS3, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.762 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
7H0O
DownloadVisualize
BU of 7h0o by Molmil
Crystal structure of SARS-CoV-2 NSP3 Macrodomain in complex with ASAP-0012310-001
Descriptor: 7-{(1S)-2-methyl-1-[(9H-purin-6-yl)amino]propyl}-3,4-dihydro-1lambda~6~-benzothiopyran-1,1(2H)-dione, Papain-like protease nsp3
Authors:Aschenbrenner, J.C, Fearon, D, Tomlinson, C.W.E, Marples, P.G, Fairhead, M, Balcomb, B.H, Chandran, A.V, Godoy, A.S, Koekemoer, L, Lithgo, R.M, Ni, X, Thompson, W, Wang, S, Wild, C, Williams, E.P, Winokan, M, Walsh, M.A, von Delft, F.
Deposit date:2024-01-23
Release date:2024-05-15
Method:X-RAY DIFFRACTION (1.18 Å)
Cite:Group deposition of SARS-CoV-2 NSP3 Macrodomain in complex with inhibitors from the ASAP AViDD centre
To Be Published
7H0Y
DownloadVisualize
BU of 7h0y by Molmil
Crystal structure of SARS-CoV-2 NSP3 Macrodomain in complex with ASAP-0013258-001
Descriptor: 4-{[(1S)-1-(1,1-dioxo-1,2,3,4-tetrahydro-1lambda~6~-benzothiopyran-7-yl)-2-methylpropyl]amino}-N-(1-methylazetidin-3-yl)-7H-pyrrolo[2,3-d]pyrimidine-6-carboxamide, Papain-like protease nsp3
Authors:Aschenbrenner, J.C, Fearon, D, Tomlinson, C.W.E, Marples, P.G, Fairhead, M, Balcomb, B.H, Chandran, A.V, Godoy, A.S, Koekemoer, L, Lithgo, R.M, Ni, X, Thompson, W, Wang, S, Wild, C, Williams, E.P, Winokan, M, Walsh, M.A, von Delft, F.
Deposit date:2024-01-23
Release date:2024-05-15
Method:X-RAY DIFFRACTION (1.51 Å)
Cite:Group deposition of SARS-CoV-2 NSP3 Macrodomain in complex with inhibitors from the ASAP AViDD centre
To Be Published
7H1V
DownloadVisualize
BU of 7h1v by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with Z31113727
Descriptor: 1-(pyridin-2-yl)piperidin-4-one, DIMETHYL SULFOXIDE, Serine protease NS3, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.36 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
7H22
DownloadVisualize
BU of 7h22 by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with Z1102357527
Descriptor: DIMETHYL SULFOXIDE, N-[(3R)-6-oxopiperidin-3-yl]-1,3-thiazole-4-carboxamide, Serine protease NS3, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.554 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
7H1L
DownloadVisualize
BU of 7h1l by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with POB0087
Descriptor: (3S)-3-(4-fluorophenyl)piperidine-3-carboxamide, DIMETHYL SULFOXIDE, Serine protease NS3, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.535 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
5E0H
DownloadVisualize
BU of 5e0h by Molmil
1.95 A resolution structure of Norovirus 3CL protease in complex with a triazole-based macrocyclic (18-mer) inhibitor
Descriptor: (phenylmethyl) ~{N}-[(9~{S},12~{S},15~{S})-9-(hydroxymethyl)-12-(2-methylpropyl)-6,11,14-tris(oxidanylidene)-1,5,10,13,18,19-hexazabicyclo[15.2.1]icosa-17(20),18-dien-15-yl]carbamate, GLYCEROL, Norovirus 3C-like protease
Authors:Lovell, S, Battaile, K.P, Mehzabeen, N, Weerawarna, P.M, Kim, Y, Kankanamalage, A.C.G, Damalanka, V.C, Lushington, G.H, Alliston, K.R, Chang, K.-O, Groutas, W.C.
Deposit date:2015-09-28
Release date:2016-05-04
Last modified:2023-09-27
Method:X-RAY DIFFRACTION (1.95 Å)
Cite:Structure-based design and synthesis of triazole-based macrocyclic inhibitors of norovirus protease: Structural, biochemical, spectroscopic, and antiviral studies.
Eur.J.Med.Chem., 119, 2016
5E3O
DownloadVisualize
BU of 5e3o by Molmil
Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)
Descriptor: DNA (27-MER), DNA-binding protein Fis
Authors:Hancock, S.P, Cascio, D, Johnson, R.C.
Deposit date:2015-10-03
Release date:2016-03-09
Last modified:2024-03-06
Method:X-RAY DIFFRACTION (2.78 Å)
Cite:DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
7H2H
DownloadVisualize
BU of 7h2h by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with Z1575274523
Descriptor: DIMETHYL SULFOXIDE, Serine protease NS3, Serine protease subunit NS2B, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.419 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
7H1Y
DownloadVisualize
BU of 7h1y by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with Z57493554
Descriptor: 4-(aminomethyl)-1-methylpyridinium, DIMETHYL SULFOXIDE, Serine protease NS3, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.371 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published
7GZB
DownloadVisualize
BU of 7gzb by Molmil
Crystal structure of SARS-CoV-2 NSP3 Macrodomain in complex with ASAP-0000495-001
Descriptor: (2R)-(2,3-dihydro-1-benzofuran-5-yl)[(7H-pyrrolo[2,3-d]pyrimidine-4-carbonyl)amino]acetic acid, Non-structural protein 3
Authors:Aschenbrenner, J.C, Fearon, D, Tomlinson, C.W.E, Marples, P.G, Fairhead, M, Balcomb, B.H, Chandran, A.V, Godoy, A.S, Koekemoer, L, Lithgo, R.M, Ni, X, Thompson, W, Wang, S, Wild, C, Williams, E.P, Winokan, M, Walsh, M.A, von Delft, F.
Deposit date:2024-01-23
Release date:2024-05-15
Method:X-RAY DIFFRACTION (1.16 Å)
Cite:Group deposition of SARS-CoV-2 NSP3 Macrodomain in complex with inhibitors from the ASAP AViDD centre
To Be Published
4BFH
DownloadVisualize
BU of 4bfh by Molmil
Crystal structure of alpha-amylase inhibitor wrightide R1 (wR1) peptide from Wrightia religiosa
Descriptor: WRIGHTIDE R1
Authors:Yap, L.J, Nguyen, P.Q.T, Tam, J.P, Lescar, J.
Deposit date:2013-03-19
Release date:2013-07-10
Last modified:2023-12-20
Method:X-RAY DIFFRACTION (1.25 Å)
Cite:Discovery and Characterization of Pseudocyclic Cystine-Knot Alpha-Amylase Inhibitors with High Resistance to Heat and Proteolytic Degradation.
FEBS J., 281, 2014
7H2F
DownloadVisualize
BU of 7h2f by Molmil
PanDDA analysis group deposition -- Crystal Structure of ZIKV NS2B-NS3 protease in complex with Z1491215378
Descriptor: DIMETHYL SULFOXIDE, N-(piperidin-4-yl)methanesulfonamide, SULFATE ION, ...
Authors:Ni, X, Godoy, A.S, Marples, P.G, Fairhead, M, Balcomb, B.H, Tomlinson, C.W.E, Koekemoer, L, Aschenbrenner, J.C, Lithgo, R.M, Thompson, W, Wild, C, Williams, E.P, Winokan, M, Chandran, A.V, Fearon, D, Walsh, M.A, von Delft, F.
Deposit date:2024-04-03
Release date:2024-05-08
Last modified:2024-05-22
Method:X-RAY DIFFRACTION (1.381 Å)
Cite:PanDDA analysis group deposition of ZIKV NS2B-NS3 protease
To Be Published

222624

PDB entries from 2024-07-17

PDB statisticsPDBj update infoContact PDBjnumon