2LUP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2lup by Molmil](/molmil-images/mine/2lup) | |
1D3X
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1d3x by Molmil](/molmil-images/mine/1d3x) | INTRAMOLECULAR DNA TRIPLEX, NMR, 10 STRUCTURES | Descriptor: | DNA (5'-D(*AP*GP*AP*GP*AP*GP*AP*A)-3'), DNA (5'-D(*TP*CP*TP*CP*TP*CP*TP*T)-3'), DNA (5'-D(*TP*TP*CP*TP*CP*TP*CP*T)-3') | Authors: | Tarkoy, M, Phipps, A.K, Schultze, P, Feigon, J. | Deposit date: | 1998-02-05 | Release date: | 1998-05-06 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution structure of an intramolecular DNA triplex linked by hexakis(ethylene glycol) units: d(AGAGAGAA-(EG)6-TTCTCTCT-(EG)6-TCTCTCTT). Biochemistry, 37, 1998
|
|
1RAW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1raw by Molmil](/molmil-images/mine/1raw) | |
1QWA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qwa by Molmil](/molmil-images/mine/1qwa) | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Descriptor: | 18S ribosomal RNA, 5'ETS | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | Deposit date: | 2003-09-01 | Release date: | 2003-11-25 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31, 2003
|
|
2LBX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2lbx by Molmil](/molmil-images/mine/2lbx) | Solution structure of the S. cerevisiae H/ACA RNP protein Nhp2p | Descriptor: | H/ACA ribonucleoprotein complex subunit 2 | Authors: | Koo, B, Park, C, Fernandez, C.F, Chim, N, Ding, Y, Chanfreau, G, Feigon, J. | Deposit date: | 2011-04-07 | Release date: | 2011-07-06 | Last modified: | 2024-05-15 | Method: | SOLUTION NMR | Cite: | Structure of H/ACA RNP Protein Nhp2p Reveals Cis/Trans Isomerization of a Conserved Proline at the RNA and Nop10 Binding Interface. J.Mol.Biol., 411, 2011
|
|
1QWB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qwb by Molmil](/molmil-images/mine/1qwb) | |
2LBW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2lbw by Molmil](/molmil-images/mine/2lbw) | Solution structure of the S. cerevisiae H/ACA RNP protein Nhp2p-S82W mutant | Descriptor: | H/ACA ribonucleoprotein complex subunit 2 | Authors: | Koo, B, Park, C, Fernandez, C.F, Chim, N, Ding, Y, Chanfreau, G, Feigon, J. | Deposit date: | 2011-04-07 | Release date: | 2011-07-06 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Structure of H/ACA RNP Protein Nhp2p Reveals Cis/Trans Isomerization of a Conserved Proline at the RNA and Nop10 Binding Interface. J.Mol.Biol., 411, 2011
|
|
1RVH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1rvh by Molmil](/molmil-images/mine/1rvh) | SOLUTION STRUCTURE OF THE DNA DODECAMER GCAAAATTTTGC | Descriptor: | 5'-D(*GP*CP*AP*AP*AP*AP*TP*TP*TP*TP*GP*C)-3' | Authors: | Stefl, R, Wu, H, Ravindranathan, S, Sklenar, V, Feigon, J. | Deposit date: | 2003-12-13 | Release date: | 2004-02-10 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | DNA A-tract bending in three dimensions: Solving the dA4T4 vs. dT4A4 conundrum. Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
2K95
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2k95 by Molmil](/molmil-images/mine/2k95) | Solution structure of the wild-type P2B-P3 pseudoknot of human telomerase RNA | Descriptor: | Telomerase RNA P2b-P3 pseudoknot | Authors: | Kim, N.-K, Zhang, Q, Zhou, J, Theimer, C.A, Peterson, R.D, Feigon, J. | Deposit date: | 2008-09-29 | Release date: | 2008-11-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution Structure and Dynamics of the Wild-type Pseudoknot of Human Telomerase RNA. J.Mol.Biol., 384, 2008
|
|
1RVI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1rvi by Molmil](/molmil-images/mine/1rvi) | SOLUTION STRUCTURE OF THE DNA DODECAMER CGTTTTAAAACG | Descriptor: | 5'-D(*CP*GP*TP*TP*TP*TP*AP*AP*AP*AP*CP*G)-3' | Authors: | Stefl, R, Wu, H, Ravindranathan, S, Sklenar, V, Feigon, J. | Deposit date: | 2003-12-13 | Release date: | 2004-02-10 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | DNA A-tract bending in three dimensions: Solving the dA4T4 vs. dT4A4 conundrum. Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
2KYE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2kye by Molmil](/molmil-images/mine/2kye) | Solution structure of the pseudouridine modified P6.1 hairpin of human telomerase RNA | Descriptor: | RNA (5'-R(*GP*AP*GP*AP*GP*(PSU)P*(PSU)P*GP*GP*GP*CP*(PSU)P*CP*(PSU)P*C)-3') | Authors: | Kim, N.-K, Theimer, C.A, Mitchell, J.R, Collins, K, Feigon, J. | Deposit date: | 2010-05-25 | Release date: | 2010-06-30 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Effect of pseudouridylation on the structure and activity of the catalytically essential P6.1 hairpin in human telomerase RNA. Nucleic Acids Res., 38, 2010
|
|
2LUJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2luj by Molmil](/molmil-images/mine/2luj) | Solution structure of a parallel-stranded oligoisoguanine DNA pentaplex formed by d(T(iG)4T) in the presence of Cs ions | Descriptor: | DNA (5'-D(*TP*(IGU)P*(IGU)P*(IGU)P*(IGU)P*T)-3') | Authors: | Kang, M, Heuberger, B, Chaput, J.C, Switzer, C, Feigon, J. | Deposit date: | 2012-06-14 | Release date: | 2012-07-25 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Solution Structure of a Parallel-Stranded Oligoisoguanine DNA Pentaplex Formed by d(T(iG)4T) in the Presence of Cs(+) Ions. Angew.Chem.Int.Ed.Engl., 51, 2012
|
|
2M21
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2m21 by Molmil](/molmil-images/mine/2m21) | Solution structure of the Tetrahymena telomerase RNA stem IV terminal loop | Descriptor: | 5'-R(*GP*GP*CP*GP*AP*UP*AP*CP*AP*CP*UP*AP*UP*UP*UP*AP*UP*CP*GP*CP*C)-3' | Authors: | Cash, D.D, Richards, R.J, Wu, H, Trantirek, L, O'Connor, C.M, Feigon, J, Collins, K. | Deposit date: | 2012-12-11 | Release date: | 2013-03-20 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Structural study of elements of Tetrahymena telomerase RNA stem-loop IV domain important for function. Rna, 12, 2006
|
|
2M22
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2m22 by Molmil](/molmil-images/mine/2m22) | Solution structure of the helix II template boundary element from Tetrahymena telomerase RNA | Descriptor: | 5'-R(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*UP*AP*AP*UP*AP*GP*AP*AP*CP*UP*GP*CP*C)-3' | Authors: | Cash, D.D, Richards, R.J, Theimer, C.A, Finger, D.L, Feigon, J. | Deposit date: | 2012-12-11 | Release date: | 2013-03-20 | Last modified: | 2024-05-15 | Method: | SOLUTION NMR | Cite: | Solution structure of the helix II template boundary element from Tetrahymena telomerase RNA Nucleic Acids Res., 34, 2006
|
|
1P3X
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1p3x by Molmil](/molmil-images/mine/1p3x) | INTRAMOLECULAR DNA TRIPLEX WITH 1-PROPYNYL DEOXYURIDINE IN THE THIRD STRAND, NMR, 10 STRUCTURES | Descriptor: | DNA (5'-D(*(PDU)P*CP*(PDU)P*(DCM)P*(PDU)P*CP*(PDU)P*(PDU))-3'), DNA (5'-D(*AP*GP*AP*GP*AP*GP*AP*A)-3'), DNA (5'-D(*TP*TP*CP*TP*CP*TP*CP*T)-3') | Authors: | Phipps, A.K, Tarkoy, M, Schultze, P, Feigon, J. | Deposit date: | 1998-02-05 | Release date: | 1998-05-06 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Solution structure of an intramolecular DNA triplex containing 5-(1-propynyl)-2'-deoxyuridine residues in the third strand. Biochemistry, 37, 1998
|
|
2MNW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2mnw by Molmil](/molmil-images/mine/2mnw) | |
1PG1
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1pg1 by Molmil](/molmil-images/mine/1pg1) | PROTEGRIN 1 (PG1) FROM PORCINE LEUKOCYTES, NMR, 20 STRUCTURES | Descriptor: | PROTEGRIN-1 | Authors: | Fahrner, R.L, Dieckmann, T, Harwig, S.S.L, Lehrer, R.I, Eisenberg, D, Feigon, J. | Deposit date: | 1998-03-20 | Release date: | 1998-05-27 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | Solution structure of protegrin-1, a broad-spectrum antimicrobial peptide from porcine leukocytes. Chem.Biol., 3, 1996
|
|
2L1V
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2l1v by Molmil](/molmil-images/mine/2l1v) | |
2LSL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2lsl by Molmil](/molmil-images/mine/2lsl) | Solution structure of the C-terminal domain of Tetrahymena telomerase protein p65 | Descriptor: | Telomerase associated protein p65 | Authors: | Singh, M, Wang, Z, Koo, B, Patel, A, Cascio, D, Collins, K, Feigon, J. | Deposit date: | 2012-05-01 | Release date: | 2012-06-20 | Last modified: | 2024-05-15 | Method: | SOLUTION NMR | Cite: | Structural Basis for Telomerase RNA Recognition and RNP Assembly by the Holoenzyme La Family Protein p65. Mol.Cell, 47, 2012
|
|
2L3E
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2l3e by Molmil](/molmil-images/mine/2l3e) | Solution structure of P2a-J2a/b-P2b of human telomerase RNA | Descriptor: | 35-MER | Authors: | Zhang, Q, Kim, N, Peterson, R.D, Wang, Z, Feigon, J. | Deposit date: | 2010-09-13 | Release date: | 2010-11-17 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Inaugural Article: Structurally conserved five nucleotide bulge determines the overall topology of the core domain of human telomerase RNA. Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
2M8K
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2m8k by Molmil](/molmil-images/mine/2m8k) | A pyrimidine motif triple helix in the Kluyveromyces lactis telomerase RNA pseudoknot is essential for function in vivo | Descriptor: | RNA (48-MER) | Authors: | Cash, D.D, Cohen, O, Kim, N, Shefer, K, Brown, Y, Ulyanov, N.B, Tzfati, Y, Feigon, J. | Deposit date: | 2013-05-22 | Release date: | 2013-06-19 | Last modified: | 2024-05-15 | Method: | SOLUTION NMR | Cite: | Pyrimidine motif triple helix in the Kluyveromyces lactis telomerase RNA pseudoknot is essential for function in vivo. Proc.Natl.Acad.Sci.USA, 110, 2013
|
|
2MHI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2mhi by Molmil](/molmil-images/mine/2mhi) | |
2MIY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2miy by Molmil](/molmil-images/mine/2miy) | |