1QWA
 
 | | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | | Descriptor: | 18S ribosomal RNA, 5'ETS | | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | | Deposit date: | 2003-09-01 | | Release date: | 2003-11-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Nucleic Acids Res., 31, 2003
|
|
2LUP
 | |
1EBQ
 | |
1EBR
 | |
1EBS
 | |
2LBW
 | | Solution structure of the S. cerevisiae H/ACA RNP protein Nhp2p-S82W mutant | | Descriptor: | H/ACA ribonucleoprotein complex subunit 2 | | Authors: | Koo, B, Park, C, Fernandez, C.F, Chim, N, Ding, Y, Chanfreau, G, Feigon, J. | | Deposit date: | 2011-04-07 | | Release date: | 2011-07-06 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Structure of H/ACA RNP Protein Nhp2p Reveals Cis/Trans Isomerization of a Conserved Proline at the RNA and Nop10 Binding Interface.
J.Mol.Biol., 411, 2011
|
|
2LBX
 | | Solution structure of the S. cerevisiae H/ACA RNP protein Nhp2p | | Descriptor: | H/ACA ribonucleoprotein complex subunit 2 | | Authors: | Koo, B, Park, C, Fernandez, C.F, Chim, N, Ding, Y, Chanfreau, G, Feigon, J. | | Deposit date: | 2011-04-07 | | Release date: | 2011-07-06 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | Structure of H/ACA RNP Protein Nhp2p Reveals Cis/Trans Isomerization of a Conserved Proline at the RNA and Nop10 Binding Interface.
J.Mol.Biol., 411, 2011
|
|
1P3X
 | | INTRAMOLECULAR DNA TRIPLEX WITH 1-PROPYNYL DEOXYURIDINE IN THE THIRD STRAND, NMR, 10 STRUCTURES | | Descriptor: | DNA (5'-D(*(PDU)P*CP*(PDU)P*(DCM)P*(PDU)P*CP*(PDU)P*(PDU))-3'), DNA (5'-D(*AP*GP*AP*GP*AP*GP*AP*A)-3'), DNA (5'-D(*TP*TP*CP*TP*CP*TP*CP*T)-3') | | Authors: | Phipps, A.K, Tarkoy, M, Schultze, P, Feigon, J. | | Deposit date: | 1998-02-05 | | Release date: | 1998-05-06 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution structure of an intramolecular DNA triplex containing 5-(1-propynyl)-2'-deoxyuridine residues in the third strand.
Biochemistry, 37, 1998
|
|
1PG1
 | | PROTEGRIN 1 (PG1) FROM PORCINE LEUKOCYTES, NMR, 20 STRUCTURES | | Descriptor: | PROTEGRIN-1 | | Authors: | Fahrner, R.L, Dieckmann, T, Harwig, S.S.L, Lehrer, R.I, Eisenberg, D, Feigon, J. | | Deposit date: | 1998-03-20 | | Release date: | 1998-05-27 | | Last modified: | 2022-02-23 | | Method: | SOLUTION NMR | | Cite: | Solution structure of protegrin-1, a broad-spectrum antimicrobial peptide from porcine leukocytes.
Chem.Biol., 3, 1996
|
|
1NA2
 | |
2LUJ
 | | Solution structure of a parallel-stranded oligoisoguanine DNA pentaplex formed by d(T(iG)4T) in the presence of Cs ions | | Descriptor: | DNA (5'-D(*TP*(IGU)P*(IGU)P*(IGU)P*(IGU)P*T)-3') | | Authors: | Kang, M, Heuberger, B, Chaput, J.C, Switzer, C, Feigon, J. | | Deposit date: | 2012-06-14 | | Release date: | 2012-07-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution Structure of a Parallel-Stranded Oligoisoguanine DNA Pentaplex Formed by d(T(iG)4T) in the Presence of Cs(+) Ions.
Angew.Chem.Int.Ed.Engl., 51, 2012
|
|
2MNW
 | |
2M22
 | | Solution structure of the helix II template boundary element from Tetrahymena telomerase RNA | | Descriptor: | 5'-R(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*UP*AP*AP*UP*AP*GP*AP*AP*CP*UP*GP*CP*C)-3' | | Authors: | Cash, D.D, Richards, R.J, Theimer, C.A, Finger, D.L, Feigon, J. | | Deposit date: | 2012-12-11 | | Release date: | 2013-03-20 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | Solution structure of the helix II template boundary element from Tetrahymena telomerase RNA
Nucleic Acids Res., 34, 2006
|
|
2M21
 | | Solution structure of the Tetrahymena telomerase RNA stem IV terminal loop | | Descriptor: | 5'-R(*GP*GP*CP*GP*AP*UP*AP*CP*AP*CP*UP*AP*UP*UP*UP*AP*UP*CP*GP*CP*C)-3' | | Authors: | Cash, D.D, Richards, R.J, Wu, H, Trantirek, L, O'Connor, C.M, Feigon, J, Collins, K. | | Deposit date: | 2012-12-11 | | Release date: | 2013-03-20 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Structural study of elements of Tetrahymena telomerase RNA stem-loop IV domain important for function.
Rna, 12, 2006
|
|
1D3X
 | | INTRAMOLECULAR DNA TRIPLEX, NMR, 10 STRUCTURES | | Descriptor: | DNA (5'-D(*AP*GP*AP*GP*AP*GP*AP*A)-3'), DNA (5'-D(*TP*CP*TP*CP*TP*CP*TP*T)-3'), DNA (5'-D(*TP*TP*CP*TP*CP*TP*CP*T)-3') | | Authors: | Tarkoy, M, Phipps, A.K, Schultze, P, Feigon, J. | | Deposit date: | 1998-02-05 | | Release date: | 1998-05-06 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Solution structure of an intramolecular DNA triplex linked by hexakis(ethylene glycol) units: d(AGAGAGAA-(EG)6-TTCTCTCT-(EG)6-TCTCTCTT).
Biochemistry, 37, 1998
|
|
1AFX
 | |
1B36
 | |
2LSL
 | | Solution structure of the C-terminal domain of Tetrahymena telomerase protein p65 | | Descriptor: | Telomerase associated protein p65 | | Authors: | Singh, M, Wang, Z, Koo, B, Patel, A, Cascio, D, Collins, K, Feigon, J. | | Deposit date: | 2012-05-01 | | Release date: | 2012-06-20 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | Structural Basis for Telomerase RNA Recognition and RNP Assembly by the Holoenzyme La Family Protein p65.
Mol.Cell, 47, 2012
|
|
2L1V
 | |
2P89
 | |
2MIY
 | |
2MHI
 | |
2M8K
 | | A pyrimidine motif triple helix in the Kluyveromyces lactis telomerase RNA pseudoknot is essential for function in vivo | | Descriptor: | RNA (48-MER) | | Authors: | Cash, D.D, Cohen, O, Kim, N, Shefer, K, Brown, Y, Ulyanov, N.B, Tzfati, Y, Feigon, J. | | Deposit date: | 2013-05-22 | | Release date: | 2013-06-19 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | Pyrimidine motif triple helix in the Kluyveromyces lactis telomerase RNA pseudoknot is essential for function in vivo.
Proc.Natl.Acad.Sci.USA, 110, 2013
|
|
