2EHO
 
 | | Crystal structure of human GINS complex | | Descriptor: | DNA replication complex GINS protein PSF1, DNA replication complex GINS protein PSF2, GINS complex subunit 3, ... | | Authors: | Choi, J.M, Lim, H.S, Kim, J.J, Song, O.K, Cho, Y. | | Deposit date: | 2007-03-07 | | Release date: | 2007-06-19 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Crystal structure of the human GINS complex
Genes Dev., 21, 2007
|
|
4BFM
 | | The crystal structure of mouse PK38 | | Descriptor: | MATERNAL EMBRYONIC LEUCINE ZIPPER KINASE, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER, SULFATE ION | | Authors: | Yoo, J.H, Cho, Y.S, Park, S.M, Cho, H.S. | | Deposit date: | 2013-03-21 | | Release date: | 2014-02-12 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | The Structures of the Kinase Domain and Uba Domain of Mpk38 Suggest the Activation Mechanism for Kinase Activity.
Acta Crystallogr.,Sect.D, 70, 2014
|
|
1N6A
 | | Structure of SET7/9 | | Descriptor: | S-ADENOSYLMETHIONINE, SET domain-containing protein 7 | | Authors: | Kwon, T.W, Chang, J.H, Kwak, E, Lee, C.W, Joachimiak, A, Kim, Y.C, Lee, J, Cho, Y. | | Deposit date: | 2002-11-09 | | Release date: | 2003-02-04 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Mechanism of histone lysine methyl transfer revealed by the structure of SET7/9-AdoMet
EMBO J., 22, 2003
|
|
1N6C
 | | Structure of SET7/9 | | Descriptor: | S-ADENOSYLMETHIONINE, SET domain-containing protein 7 | | Authors: | Kwon, T.W, Chang, J.H, Cho, Y. | | Deposit date: | 2002-11-09 | | Release date: | 2003-02-04 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Mechanism of histone lysine methyl transfer revealed by the structure of SET7/9-AdoMet
EMBO J., 22, 2003
|
|
1N4M
 | | Structure of Rb tumor suppressor bound to the transactivation domain of E2F-2 | | Descriptor: | Retinoblastoma Pocket, Transcription factor E2F2 | | Authors: | Lee, C, Chang, J.H, Lee, H.S, Cho, Y. | | Deposit date: | 2002-10-31 | | Release date: | 2003-01-07 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Structural basis for the recognition of the E2F transactivation domain by the retinoblastoma tumor suppressor
GENES DEV., 16, 2002
|
|
1M2N
 | |
2NWG
 | | Structure of CXCL12:heparin disaccharide complex | | Descriptor: | 4-deoxy-2-O-sulfo-alpha-L-threo-hex-4-enopyranuronic acid-(1-4)-2-deoxy-6-O-sulfo-2-(sulfoamino)-alpha-D-glucopyranose, Stromal cell-derived factor 1 | | Authors: | Murphy, J.W, Cho, Y, Lolis, E. | | Deposit date: | 2006-11-14 | | Release date: | 2007-02-13 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.07 Å) | | Cite: | Structural and Functional Basis of CXCL12 (Stromal Cell-derived Factor-1{alpha}) Binding to Heparin
J.Biol.Chem., 282, 2007
|
|
1GH6
 | | RETINOBLASTOMA POCKET COMPLEXED WITH SV40 LARGE T ANTIGEN | | Descriptor: | Large T antigen, Retinoblastoma-associated protein | | Authors: | Kim, H.Y, Cho, Y. | | Deposit date: | 2000-11-15 | | Release date: | 2001-11-15 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Structural basis for the inactivation of retinoblastoma tumor suppressor by SV40 large T antigen.
EMBO J., 20, 2001
|
|
2KLO
 | | Structure of the Cdt1 C-terminal domain | | Descriptor: | DNA replication factor Cdt1 | | Authors: | Khayrutdinov, B.I, Bae, W.J, Yun, Y.M, Tsuyama, T, Kim, J.J, Hwang, E, Ryu, K.-S, Cheong, H.-K, Cheong, C, Karplus, P.A, Guntert, P, Tada, S, Jeon, Y.H, Cho, Y. | | Deposit date: | 2009-07-06 | | Release date: | 2009-10-13 | | Last modified: | 2024-05-29 | | Method: | SOLUTION NMR | | Cite: | Structure of the Cdt1 C-terminal domain: Conservation of the winged helix fold in replication licensing factors
Protein Sci., 18, 2009
|
|
1M2K
 | | Sir2 homologue F159A mutant-ADP ribose complex | | Descriptor: | ADENOSINE-5-DIPHOSPHORIBOSE, Silent Information Regulator 2, ZINC ION | | Authors: | Chang, J, Cho, Y. | | Deposit date: | 2002-06-24 | | Release date: | 2003-04-08 | | Last modified: | 2024-05-29 | | Method: | X-RAY DIFFRACTION (1.47 Å) | | Cite: | Structural basis for the NAD-dependent deacetylase mechanism of Sir2
J.BIOL.CHEM., 277, 2002
|
|
1M2G
 | | Sir2 homologue-ADP ribose complex | | Descriptor: | ADENOSINE-5-DIPHOSPHORIBOSE, Silent Information Regulator 2, ZINC ION | | Authors: | Chang, J, Cho, Y. | | Deposit date: | 2002-06-24 | | Release date: | 2003-04-08 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Structural basis for the NAD-dependent deacetylase mechanism of Sir2
J.BIOL.CHEM., 277, 2002
|
|
1M2H
 | | Sir2 homologue S24A mutant-ADP ribose complex | | Descriptor: | ADENOSINE-5-DIPHOSPHORIBOSE, Silent Information Regulator 2, ZINC ION | | Authors: | Chang, J, Cho, Y. | | Deposit date: | 2002-06-24 | | Release date: | 2003-04-08 | | Last modified: | 2024-05-29 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Structural basis for the NAD-dependent deacetylase mechanism of Sir2
J.BIOL.CHEM., 277, 2002
|
|
1M2J
 | | Sir2 homologue H80N mutant-ADP ribose complex | | Descriptor: | ADENOSINE-5-DIPHOSPHORIBOSE, Silent Information Regulator 2, ZINC ION | | Authors: | Chang, J, Cho, Y. | | Deposit date: | 2002-06-24 | | Release date: | 2003-04-08 | | Last modified: | 2024-05-29 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Structural basis for the NAD-dependent deacetylase mechanism of Sir2
J.BIOL.CHEM., 277, 2002
|
|
7YQ4
 | | human insulin receptor bound with A62 DNA aptamer and insulin - locally refined | | Descriptor: | IR-A62 aptamer, Insulin A chain, Insulin, ... | | Authors: | Kim, J, Yunn, N, Ryu, S, Cho, Y. | | Deposit date: | 2022-08-05 | | Release date: | 2022-11-09 | | Last modified: | 2024-10-30 | | Method: | ELECTRON MICROSCOPY (3.95 Å) | | Cite: | Functional selectivity of insulin receptor revealed by aptamer-trapped receptor structures.
Nat Commun, 13, 2022
|
|
7YQ3
 | | human insulin receptor bound with A43 DNA aptamer and insulin | | Descriptor: | IR-A43 aptamer, Insulin A chain, Insulin, ... | | Authors: | Kim, J, Yunn, N, Ryu, S, Cho, Y. | | Deposit date: | 2022-08-05 | | Release date: | 2022-11-09 | | Last modified: | 2024-11-20 | | Method: | ELECTRON MICROSCOPY (3.6 Å) | | Cite: | Functional selectivity of insulin receptor revealed by aptamer-trapped receptor structures.
Nat Commun, 13, 2022
|
|
7YQ6
 | | human insulin receptor bound with A62 DNA aptamer | | Descriptor: | IR-A62 aptamer, Isoform Short of Insulin receptor | | Authors: | Kim, J, Yunn, N, Ryu, S, Cho, Y. | | Deposit date: | 2022-08-05 | | Release date: | 2022-11-09 | | Last modified: | 2024-11-13 | | Method: | ELECTRON MICROSCOPY (4.18 Å) | | Cite: | Functional selectivity of insulin receptor revealed by aptamer-trapped receptor structures.
Nat Commun, 13, 2022
|
|
7YQ5
 | | human insulin receptor bound with A62 DNA aptamer and insulin | | Descriptor: | IR-A62 aptamer, Insulin A chain, Insulin, ... | | Authors: | Kim, J, Yunn, N, Ryu, S, Cho, Y. | | Deposit date: | 2022-08-05 | | Release date: | 2022-11-09 | | Last modified: | 2024-11-06 | | Method: | ELECTRON MICROSCOPY (4.27 Å) | | Cite: | Functional selectivity of insulin receptor revealed by aptamer-trapped receptor structures.
Nat Commun, 13, 2022
|
|
4P0P
 | | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA, and Mg2+ | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
1R6M
 | | Crystal Structure Of The tRNA Processing Enzyme Rnase pH From Pseudomonas Aeruginosa In Complex With Phosphate | | Descriptor: | PHOSPHATE ION, Ribonuclease PH | | Authors: | Choi, J.M, Park, E.Y, Kim, J.H, Chang, S.K, Cho, Y. | | Deposit date: | 2003-10-15 | | Release date: | 2004-02-17 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Probing the functional importance of the hexameric ring structure of RNase PH
J.BIOL.CHEM., 279, 2004
|
|
4P0R
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6.501 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
1R6L
 | | Crystal Structure Of The tRNA Processing Enzyme Rnase pH From Pseudomonas Aeruginosa | | Descriptor: | 2-[N-CYCLOHEXYLAMINO]ETHANE SULFONIC ACID, Ribonuclease PH, SULFATE ION | | Authors: | Choi, J.M, Park, E.Y, Kim, J.H, Chang, S.K, Cho, Y. | | Deposit date: | 2003-10-15 | | Release date: | 2004-02-17 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Probing the functional importance of the hexameric ring structure of RNase PH
J.BIOL.CHEM., 279, 2004
|
|
7WRS
 | |
7WRU
 | |
4P0Q
 | | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.851 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0S
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
