5E3O
 
 | |
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
3L1F
 | | Bovine AlphaA crystallin | | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, Alpha-crystallin A chain | | Authors: | Laganowsky, A, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2009-12-11 | | Release date: | 2010-05-12 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.53 Å) | | Cite: | Crystal structures of truncated alphaA and alphaB crystallins reveal structural mechanisms of polydispersity important for eye lens function.
Protein Sci., 19, 2010
|
|
3L1E
 | | Bovine AlphaA crystallin Zinc Bound | | Descriptor: | Alpha-crystallin A chain, GLYCEROL, ZINC ION | | Authors: | Laganowsky, A, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2009-12-11 | | Release date: | 2010-05-12 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.15 Å) | | Cite: | Crystal structures of truncated alphaA and alphaB crystallins reveal structural mechanisms of polydispersity important for eye lens function.
Protein Sci., 19, 2010
|
|
3L1G
 | | Human AlphaB crystallin | | Descriptor: | Alpha-crystallin B chain, SULFATE ION | | Authors: | Laganowsky, A, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2009-12-11 | | Release date: | 2010-05-12 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3.32 Å) | | Cite: | Crystal structures of truncated alphaA and alphaB crystallins reveal structural mechanisms of polydispersity important for eye lens function.
Protein Sci., 19, 2010
|
|
4LOW
 | | Structure and identification of a pterin dehydratase-like protein as a RuBisCO assembly factor in the alpha-carboxysome | | Descriptor: | FORMIC ACID, NICKEL (II) ION, acRAF | | Authors: | Wheatley, N.M, Gidaniyan, S.D, Cascio, D, Yeates, T.O. | | Deposit date: | 2013-07-13 | | Release date: | 2013-09-11 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.3 Å) | | Cite: | Structure and Identification of a Pterin Dehydratase-like Protein as a Ribulose-bisphosphate Carboxylase/Oxygenase (RuBisCO) Assembly Factor in the alpha-Carboxysome.
J.Biol.Chem., 289, 2014
|
|
4NJ8
 | |
3OGI
 | | Crystal structure of the Mycobacterium tuberculosis H37Rv EsxOP complex (Rv2346c-Rv2347c) | | Descriptor: | Putative ESAT-6-like protein 6, Putative ESAT-6-like protein 7 | | Authors: | Arbing, M.A, Chan, S, Zhou, T.T, Ahn, C, Harris, L, Kuo, E, Sawaya, M.R, Cascio, D, Eisenberg, D, Integrated Center for Structure and Function Innovation (ISFI), TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2010-08-16 | | Release date: | 2010-08-25 | | Last modified: | 2014-05-21 | | Method: | X-RAY DIFFRACTION (2.549 Å) | | Cite: | Heterologous expression of mycobacterial Esx complexes in Escherichia coli for structural studies is facilitated by the use of maltose binding protein fusions.
Plos One, 8, 2013
|
|
3EUD
 | | Structure of the CS domain of the essential H/ACA RNP assembly protein Shq1p | | Descriptor: | Protein SHQ1 | | Authors: | Singh, M, Cascio, D, Gonzales, F.A, Heckmann, N, Chanfreau, G, Feigon, J. | | Deposit date: | 2008-10-09 | | Release date: | 2008-11-18 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structure and Functional Studies of the CS Domain of the Essential H/ACA Ribonucleoparticle Assembly Protein SHQ1.
J.Biol.Chem., 284, 2009
|
|
3G3X
 | | Crystal structure of spin labeled T4 Lysozyme (T151R1) at 100 K | | Descriptor: | 2-HYDROXYETHYL DISULFIDE, AZIDE ION, CHLORIDE ION, ... | | Authors: | Fleissner, M.R, Cascio, D, Hubbell, W.L. | | Deposit date: | 2009-02-02 | | Release date: | 2009-05-05 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Structural origin of weakly ordered nitroxide motion in spin-labeled proteins.
Protein Sci., 18, 2009
|
|
3G3V
 | | Crystal structure of spin labeled T4 Lysozyme (V131R1) at 291 K | | Descriptor: | 2-HYDROXYETHYL DISULFIDE, AZIDE ION, CHLORIDE ION, ... | | Authors: | Fleissner, M.R, Cascio, D, Hubbell, W.L. | | Deposit date: | 2009-02-02 | | Release date: | 2009-05-05 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Structural origin of weakly ordered nitroxide motion in spin-labeled proteins.
Protein Sci., 18, 2009
|
|
3G3W
 | | Crystal structure of spin labeled T4 Lysozyme (T151R1) at 291 K | | Descriptor: | 2-HYDROXYETHYL DISULFIDE, AZIDE ION, CHLORIDE ION, ... | | Authors: | Fleissner, M.R, Cascio, D, Hubbell, W.L. | | Deposit date: | 2009-02-02 | | Release date: | 2009-05-05 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Structural origin of weakly ordered nitroxide motion in spin-labeled proteins.
Protein Sci., 18, 2009
|
|
4D9J
 | |
4E4E
 | |
4EDI
 | | Disulfide bonded EutL from Clostridium perfringens | | Descriptor: | Ethanolamine utilization protein, SODIUM ION | | Authors: | Thompson, M.C, Cascio, D, Crowley, C.S, Kopstein, J.S, Yeates, T.O. | | Deposit date: | 2012-03-27 | | Release date: | 2013-03-27 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (1.998 Å) | | Cite: | An allosteric model for control of pore opening by substrate binding in the EutL microcompartment shell protein.
Protein Sci., 24, 2015
|
|
4ERD
 | | Crystal structure of the C-terminal domain of Tetrahymena telomerase protein p65 in complex with stem IV of telomerase RNA | | Descriptor: | 5'-R(P*GP*GP*UP*CP*GP*AP*CP*AP*UP*CP*UP*UP*CP*GP*GP*AP*UP*GP*GP*AP*CP*C)-3', POTASSIUM ION, Telomerase associated protein p65 | | Authors: | Singh, M, Wang, Z, Koo, B.-K, Patel, A, Cascio, D, Collins, K, Feigon, J. | | Deposit date: | 2012-04-19 | | Release date: | 2012-06-20 | | Last modified: | 2017-11-15 | | Method: | X-RAY DIFFRACTION (2.589 Å) | | Cite: | Structural Basis for Telomerase RNA Recognition and RNP Assembly by the Holoenzyme La Family Protein p65.
Mol.Cell, 47, 2012
|
|
3LE4
 | |
4EYT
 | | Crystal structure of the C-terminal domain of Tetrahymena telomerase protein p65 | | Descriptor: | SULFATE ION, Telomerase associated protein p65 | | Authors: | Singh, M, Wang, Z, Koo, B.-K, Patel, A, Cascio, D, Collins, K, Feigon, J. | | Deposit date: | 2012-05-01 | | Release date: | 2012-06-20 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Structural Basis for Telomerase RNA Recognition and RNP Assembly by the Holoenzyme La Family Protein p65.
Mol.Cell, 47, 2012
|
|
4FDZ
 | | EutL from Clostridium perfringens, Crystallized Under Reducing Conditions | | Descriptor: | Ethanolamine utilization protein, SODIUM ION | | Authors: | Thompson, M.C, Cascio, D, Crowley, C.S, Kopstein, J.S, Yeates, T.O. | | Deposit date: | 2012-05-29 | | Release date: | 2013-05-29 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (1.802 Å) | | Cite: | An allosteric model for control of pore opening by substrate binding in the EutL microcompartment shell protein.
Protein Sci., 24, 2015
|
|
4F6E
 | | Crystal Structure of the K182R, A183P mutant manganese superoxide dismutase from Sacchromyces cerevisiae | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, GLYCEROL, MANGANESE (II) ION, ... | | Authors: | Sheng, Y, Cascio, D, Valentine, J.S. | | Deposit date: | 2012-05-14 | | Release date: | 2013-06-12 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Crystal Structure of the K182R, A183P mutant manganese superoxide dismutase from Sacchromyces cerevisiae
to be published
|
|
5V5B
 | | KVQIINKKLD, Structure of the amyloid spine from microtubule associated protein tau Repeat 2 | | Descriptor: | Microtubule-associated protein tau | | Authors: | Seidler, P.M, Sawaya, M.R, Rodriguez, J.A, Eisenberg, D.S, Cascio, D, Boyer, D.R. | | Deposit date: | 2017-03-13 | | Release date: | 2018-02-07 | | Last modified: | 2024-03-13 | | Method: | ELECTRON CRYSTALLOGRAPHY (1.5 Å) | | Cite: | Structure-based inhibitors of tau aggregation.
Nat Chem, 10, 2018
|
|
5V5C
 | | VQIINK, Structure of the amyloid-spine from microtubule associated protein tau Repeat 2 | | Descriptor: | Microtubule-associated protein tau | | Authors: | Seidler, P.M, Sawaya, M.R, Rodriguez, J.A, Eisenberg, D.S, Cascio, D, Boyer, D.R. | | Deposit date: | 2017-03-14 | | Release date: | 2018-02-07 | | Last modified: | 2024-03-13 | | Method: | ELECTRON CRYSTALLOGRAPHY (1.25 Å) | | Cite: | Structure-based inhibitors of tau aggregation.
Nat Chem, 10, 2018
|
|
5VKZ
 | | Crystal structure of Mdm12 and combinatorial reconstitution of Mdm12/Mmm1 ERMES complexes for structural studies | | Descriptor: | Mitochondrial distribution and morphology protein 12 | | Authors: | Egea, P.F, AhYoung, A.P, Lu, B, Tan, H.R, Cascio, D. | | Deposit date: | 2017-04-24 | | Release date: | 2017-07-05 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (4.1 Å) | | Cite: | Crystal structure of Mdm12 and combinatorial reconstitution of Mdm12/Mmm1 ERMES complexes for structural studies.
Biochem. Biophys. Res. Commun., 488, 2017
|
|
5W52
 | | MicroED structure of the segment, DLIIKGISVHI, from the RRM2 of TDP-43, residues 247-257 | | Descriptor: | TAR DNA-binding protein 43 | | Authors: | Guenther, E.L, Sawaya, M.R, Cascio, D, Eisenberg, D.S. | | Deposit date: | 2017-06-13 | | Release date: | 2018-02-21 | | Last modified: | 2024-04-03 | | Method: | ELECTRON CRYSTALLOGRAPHY (1.4 Å) | | Cite: | Atomic-level evidence for packing and positional amyloid polymorphism by segment from TDP-43 RRM2.
Nat. Struct. Mol. Biol., 25, 2018
|
|
3OEI
 | | Crystal structure of Mycobacterium tuberculosis RelJK (Rv3357-Rv3358-RelBE3) | | Descriptor: | CITRATE ANION, RelJ (Antitoxin Rv3357), RelK (Toxin Rv3358) | | Authors: | Miallau, L, Cascio, D, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2010-08-12 | | Release date: | 2011-03-16 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.145 Å) | | Cite: | Comparative proteomics identifies the cell-associated lethality of M. tuberculosis RelBE-like toxin-antitoxin complexes.
Structure, 21, 2013
|
|
