1FG0
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 1fg0 by Molmil](/molmil-images/mine/1fg0) | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1FFZ
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 1ffz by Molmil](/molmil-images/mine/1ffz) | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1TTT
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 1ttt by Molmil](/molmil-images/mine/1ttt) | Phe-tRNA, elongation factoR EF-TU:GDPNP ternary complex | Descriptor: | MAGNESIUM ION, OF ELONGATION FACTOR TU (EF-TU), PHENYLALANINE, ... | Authors: | Nissen, P, Kjeldgaard, M, Thirup, S, Polekhina, G, Reshetnikova, L, Clark, B.F.C, Nyborg, J. | Deposit date: | 1995-11-16 | Release date: | 1996-12-23 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structure of the ternary complex of Phe-tRNAPhe, EF-Tu, and a GTP analog. Science, 270, 1995
|
|
1B23
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 1b23 by Molmil](/molmil-images/mine/1b23) | E. coli cysteinyl-tRNA and T. aquaticus elongation factor EF-TU:GTP ternary complex | Descriptor: | CYSTEINE, CYSTEINYL TRNA, ELONGATION FACTOR TU, ... | Authors: | Nissen, P, Kjeldgaard, M, Thirup, S, Nyborg, J. | Deposit date: | 1998-12-04 | Release date: | 1998-12-07 | Last modified: | 2023-08-09 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | The crystal structure of Cys-tRNACys-EF-Tu-GDPNP reveals general and specific features in the ternary complex and in tRNA. Structure Fold.Des., 7, 1999
|
|
7ZGO
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 7zgo by Molmil](/molmil-images/mine/7zgo) | Cryo-EM structure of human NKCC1 (TM domain) | Descriptor: | (2S)-3-(hexadecanoyloxy)-2-[(9Z)-octadec-9-enoyloxy]propyl 2-(trimethylammonio)ethyl phosphate, CHLORIDE ION, CHOLESTEROL HEMISUCCINATE, ... | Authors: | Nissen, P, Fenton, R, Neumann, C, Lindtoft Rosenbaek, L, Kock Flygaard, R, Habeck, M, Lykkegaard Karlsen, J, Wang, Y, Lindorff-Larsen, K, Gad, H, Hartmann, R, Lyons, J. | Deposit date: | 2022-04-04 | Release date: | 2022-10-05 | Last modified: | 2023-04-19 | Method: | ELECTRON MICROSCOPY (2.55 Å) | Cite: | Cryo-EM structure of the human NKCC1 transporter reveals mechanisms of ion coupling and specificity. Embo J., 41, 2022
|
|
3DWU
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 3dwu by Molmil](/molmil-images/mine/3dwu) | |
4UU0
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 4uu0 by Molmil](/molmil-images/mine/4uu0) | CRYSTAL STRUCTURE OF (SR) CALCIUM-ATPASE E2(TG) IN THE PRESENCE OF 14:1 PC | Descriptor: | GLYCEROL, MAGNESIUM ION, OCTANOIC ACID [3S-[3ALPHA, ... | Authors: | Drachmann, N.D, Olesen, C, Moeller, J.V, Guo, Z, Nissen, P, Bublitz, M. | Deposit date: | 2014-07-24 | Release date: | 2014-10-01 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Comparing Crystal Structures of Ca(2+) -ATPase in the Presence of Different Lipids. FEBS J., 281, 2014
|
|
1N0V
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 1n0v by Molmil](/molmil-images/mine/1n0v) | Crystal structure of elongation factor 2 | Descriptor: | Elongation factor 2 | Authors: | Joergensen, R, Ortiz, P.A, Carr-Schmid, A, Nissen, P, Kinzy, T.G, Andersen, G.R. | Deposit date: | 2002-10-15 | Release date: | 2002-11-27 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.85 Å) | Cite: | Two crystal structures demonstrate large conformational changes in the eukaryotic ribosomal translocase. Nat.Struct.Biol., 10, 2003
|
|
5JAE
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 5jae by Molmil](/molmil-images/mine/5jae) | LeuT in the outward-oriented, Na+-free return state, P21 form at pH 6.5 | Descriptor: | Transporter, octyl beta-D-glucopyranoside | Authors: | Malinauskaite, L, Sahin, C, Said, S, Grouleff, J, Shahsavar, A, Bjerregaard, H, Noer, P, Severinsen, K, Boesen, T, Schiott, B, Sinning, S, Nissen, P. | Deposit date: | 2016-04-12 | Release date: | 2016-06-01 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | A conserved leucine occupies the empty substrate site of LeuT in the Na(+)-free return state. Nat Commun, 7, 2016
|
|
6RB2
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 6rb2 by Molmil](/molmil-images/mine/6rb2) | Structure of the (SR)Ca2+-ATPase mutant E340A in the Ca2-E1-CaAMPPCP form | Descriptor: | CALCIUM ION, PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER, POTASSIUM ION, ... | Authors: | Clausen, J.D, Montigny, C, Lenoir, G, Arnou, B, Jaxel, C, Moller, J.V, Nissen, P, Andersen, J.P, Le Maire, M, Bublitz, M. | Deposit date: | 2019-04-09 | Release date: | 2020-05-06 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (3.20001125 Å) | Cite: | The SERCA residue Glu340 mediates interdomain communication that guides Ca 2+ transport. Proc.Natl.Acad.Sci.USA, 117, 2020
|
|
5JAF
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 5jaf by Molmil](/molmil-images/mine/5jaf) | LeuT Na+-free Return State, C2 form at pH 5 | Descriptor: | Transporter, octyl beta-D-glucopyranoside | Authors: | Malinauskaite, L, Sahin, C, Said, S, Grouleff, J, Shahsavar, A, Bjerregaard, H, Noer, P, Severinsen, K, Boesen, T, Schiott, B, Sinning, S, Nissen, P. | Deposit date: | 2016-04-12 | Release date: | 2016-06-01 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.021 Å) | Cite: | A conserved leucine occupies the empty substrate site of LeuT in the Na(+)-free return state. Nat Commun, 7, 2016
|
|
5JAG
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 5jag by Molmil](/molmil-images/mine/5jag) | LeuT T354H mutant in the outward-oriented, Na+-free Return State | Descriptor: | Transporter, octyl beta-D-glucopyranoside | Authors: | Malinauskaite, L, Sahin, C, Said, S, Grouleff, J, Shahsavar, A, Bjerregaard, H, Noer, P, Severinsen, K, Boesen, T, Schiott, B, Sinning, S, Nissen, P. | Deposit date: | 2016-04-12 | Release date: | 2016-06-01 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.58 Å) | Cite: | A conserved leucine occupies the empty substrate site of LeuT in the Na(+)-free return state. Nat Commun, 7, 2016
|
|
4US7
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 4us7 by Molmil](/molmil-images/mine/4us7) | Sulfur SAD Phased Structure of a Type IV Pilus Protein from Shewanella oneidensis | Descriptor: | PILD PROCESSED PROTEIN, SODIUM ION, SULFATE ION | Authors: | Gorgel, M, Boeggild, A, Ulstrup, J.J, Mueller, U, Weiss, M, Nissen, P, Boesen, T. | Deposit date: | 2014-07-03 | Release date: | 2015-04-29 | Method: | X-RAY DIFFRACTION (1.96 Å) | Cite: | High-Resolution Structure of a Type Iv Pilin from the Metal- Reducing Bacterium Shewanella Oneidensis. Bmc Struct.Biol., 15, 2015
|
|
4US4
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 4us4 by Molmil](/molmil-images/mine/4us4) | Crystal Structure of the Bacterial NSS Member MhsT in an Occluded Inward-Facing State (lipidic cubic phase form) | Descriptor: | (2R)-2,3-DIHYDROXYPROPYL(7Z)-PENTADEC-7-ENOATE, (2S)-2,3-DIHYDROXYPROPYL(7Z)-PENTADEC-7-ENOATE, SODIUM ION, ... | Authors: | Malinauskaite, L, Quick, M, Reinhard, L, Lyons, J.A, Yano, H, Javitch, J.A, Nissen, P. | Deposit date: | 2014-07-02 | Release date: | 2014-09-24 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | A Mechanism for Intracellular Release of Na+ by Neurotransmitter/Sodium Symporters Nat.Struct.Mol.Biol., 21, 2014
|
|
5KSD
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 5ksd by Molmil](/molmil-images/mine/5ksd) | Crystal Structure of a Plasma Membrane Proton Pump | Descriptor: | ATPase 2, plasma membrane-type, DODECYL-BETA-D-MALTOSIDE, ... | Authors: | Croll, T, Pedersen, B.P, Nissen, P. | Deposit date: | 2016-07-08 | Release date: | 2016-08-10 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (3.5 Å) | Cite: | Improved Model of Proton Pump Crystal Structure Obtained by Interactive Molecular Dynamics Flexible Fitting Expands the Mechanistic Model for Proton Translocation in P-Type ATPases. Front Physiol, 8, 2017
|
|
5I32
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 5i32 by Molmil](/molmil-images/mine/5i32) | Ammonia permeable aquaporin AtTIP2;1 | Descriptor: | Aquaporin TIP2-1 | Authors: | Kirscht, A, Nissen, P, Kjellbom, P, Gourdon, P, Johanson, U. | Deposit date: | 2016-02-09 | Release date: | 2016-04-06 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.18 Å) | Cite: | Crystal Structure of an Ammonia-Permeable Aquaporin. Plos Biol., 14, 2016
|
|
4NAB
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 4nab by Molmil](/molmil-images/mine/4nab) | Structure of the (SR)Ca2+-ATPase mutant E309Q in the Ca2-E1-MgAMPPCP form | Descriptor: | 1,2-DIOLEOYL-SN-GLYCERO-3-PHOSPHOCHOLINE, CALCIUM ION, POTASSIUM ION, ... | Authors: | Bublitz, M, Clausen, J.D, Arnou, B, Montigny, C, Jaxel, C, Nissen, P, Moller, J.V, Andersen, J.P, le Maire, M. | Deposit date: | 2013-10-22 | Release date: | 2013-12-18 | Last modified: | 2017-08-09 | Method: | X-RAY DIFFRACTION (3.5 Å) | Cite: | SERCA mutant E309Q binds two Ca(2+) ions but adopts a catalytically incompetent conformation. Embo J., 32, 2013
|
|
4XOU
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 4xou by Molmil](/molmil-images/mine/4xou) | Crystal structure of the SR Ca2+-ATPase in the Ca2-E1-MgAMPPCP form determined by serial femtosecond crystallography using an X-ray free-electron laser. | Descriptor: | CALCIUM ION, PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER, POTASSIUM ION, ... | Authors: | Bublitz, M, Nass, K, Drachmann, N.D, Markvardsen, A.J, Gutmann, M.J, Barends, T.R.M, Mattle, D, Shoeman, R.L, Doak, R.B, Boutet, S, Messerschmidt, M, Seibert, M.M, Williams, G.J, Foucar, L, Reinhard, L, Sitsel, O, Gregersen, J.L, Clausen, J.D, Boesen, T, Gotfryd, K, Wang, K.-T, Olesen, C, Moller, J.V, Nissen, P, Schlichting, I. | Deposit date: | 2015-01-16 | Release date: | 2015-06-10 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Structural studies of P-type ATPase-ligand complexes using an X-ray free-electron laser. Iucrj, 2, 2015
|
|
4XE5
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 4xe5 by Molmil](/molmil-images/mine/4xe5) | Crystal structure of the Na,K-ATPase from bovine | Descriptor: | CHOLESTEROL, MAGNESIUM ION, OUABAIN, ... | Authors: | Gregersen, J.L, Mattle, D, Fedosova, N.U, Nissen, P, Reinhard, L. | Deposit date: | 2014-12-22 | Release date: | 2016-03-09 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.901 Å) | Cite: | Isolation, crystallization and crystal structure determination of bovine kidney Na(+),K(+)-ATPase. Acta Crystallogr.,Sect.F, 72, 2016
|
|
7YZR
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 7yzr by Molmil](/molmil-images/mine/7yzr) | 50 mM Rb+ soak of beryllium fluoride inhibited Na+,K+-ATPase, E2-BeFx (rigid body model) | Descriptor: | BERYLLIUM TRIFLUORIDE ION, FXYD domain-containing ion transport regulator, MAGNESIUM ION, ... | Authors: | Fruergaard, M.U, Dach, I, Andersen, J.L, Ozol, M, Shasavar, A, Quistgaard, E.M, Poulsen, H, Fedosova, N.U, Nissen, P. | Deposit date: | 2022-02-21 | Release date: | 2022-11-23 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (6.92 Å) | Cite: | The Na + ,K + -ATPase in complex with beryllium fluoride mimics an ATPase phosphorylated state. J.Biol.Chem., 298, 2022
|
|
7Z04
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 7z04 by Molmil](/molmil-images/mine/7z04) | 10 mM Rb+ soak of beryllium fluoride inhibited Na+,K+-ATPase, E2-BeFx (rigid body model) | Descriptor: | BERYLLIUM TRIFLUORIDE ION, FXYD domain-containing ion transport regulator, MAGNESIUM ION, ... | Authors: | Fruergaard, M.U, Dach, I, Andersen, J.L, Ozol, M, Shasavar, A, Quistgaard, E.M, Poulsen, H, Fedosova, N.U, Nissen, P. | Deposit date: | 2022-02-22 | Release date: | 2022-11-23 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (7.5 Å) | Cite: | The Na + ,K + -ATPase in complex with beryllium fluoride mimics an ATPase phosphorylated state. J.Biol.Chem., 298, 2022
|
|
1FFK
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 1ffk by Molmil](/molmil-images/mine/1ffk) | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-25 | Release date: | 2000-08-14 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution. Science, 289, 2000
|
|
4UU1
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 4uu1 by Molmil](/molmil-images/mine/4uu1) | CRYSTAL STRUCTURE OF (SR) CALCIUM-ATPASE E2(TG) IN THE PRESENCE OF DOPC | Descriptor: | 1,2-DIOLEOYL-SN-GLYCERO-3-PHOSPHOCHOLINE, GLYCEROL, MAGNESIUM ION, ... | Authors: | Drachmann, N.D, Olesen, C, Moeller, J.V, Guo, Z, Nissen, P, Bublitz, M. | Deposit date: | 2014-07-24 | Release date: | 2014-10-01 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Comparing Crystal Structures of Ca(2+) -ATPase in the Presence of Different Lipids. FEBS J., 281, 2014
|
|
4V69
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 4v69 by Molmil](/molmil-images/mine/4v69) | Ternary complex-bound E.coli 70S ribosome. | Descriptor: | 16S rRNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | Authors: | Villa, E, Sengupta, J, Trabuco, L.G, LeBarron, J, Baxter, W.T, Shaikh, T.R, Grassucci, R.A, Nissen, P, Ehrenberg, M, Schulten, K, Frank, J. | Deposit date: | 2008-12-11 | Release date: | 2014-07-09 | Last modified: | 2024-02-28 | Method: | ELECTRON MICROSCOPY (6.7 Å) | Cite: | Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis Proc.Natl.Acad.Sci.USA, 106, 2009
|
|
4UMV
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 4umv by Molmil](/molmil-images/mine/4umv) | CRYSTAL STRUCTURE OF A ZINC-TRANSPORTING PIB-TYPE ATPASE IN THE E2P STATE | Descriptor: | BERYLLIUM TRIFLUORIDE ION, MAGNESIUM ION, ZINC-TRANSPORTING ATPASE | Authors: | Wang, K.T, Sitsel, O, Meloni, G, Autzen, H.E, Andersson, M, Klymchuk, T, Nielsen, A.M, Rees, D.C, Nissen, P, Gourdon, P. | Deposit date: | 2014-05-21 | Release date: | 2014-08-13 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | Structure and Mechanism of Zn(2+)-Transporting P-Type Atpases. Nature, 514, 2014
|
|