1LVJ
| |
2AXY
| Crystal Structure of KH1 domain of human Poly(C)-binding protein-2 with C-rich strand of human telomeric DNA | Descriptor: | C-rich strand of human telomeric dna, Poly(rC)-binding protein 2 | Authors: | Du, Z, Lee, J.K, Tjhen, R.J, Li, S, Stroud, R.M, James, T.L. | Deposit date: | 2005-09-06 | Release date: | 2005-09-27 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Crystal Structure of the First KH Domain of Human Poly(C)-binding Protein-2 in Complex with a C-rich Strand of Human Telomeric DNA at 1.7 A J.Biol.Chem., 280, 2005
|
|
1R7W
| NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
1R7Z
| NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
1ROQ
| |
1TXS
| STEM-LOOP D OF THE CLOVERLEAF DOMAIN OF ENTEROVIRAL 5'UTR RNA | Descriptor: | Enteroviral 5'-UTR | Authors: | Du, Z, Yu, J, Ulyanov, N.B, Andino, R, James, T.L. | Deposit date: | 2004-07-06 | Release date: | 2004-10-05 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution Structure of a Consensus Stem-Loop D RNA Domain that Plays Important Roles in Regulating Translation and Replication in Enteroviruses and Rhinoviruses Biochemistry, 43, 2004
|
|
2JZX
| PCBP2 KH1-KH2 domains | Descriptor: | Poly(rC)-binding protein 2 | Authors: | Du, Z, Fenn, S, Tjhen, R, James, T. | Deposit date: | 2008-01-21 | Release date: | 2008-08-12 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Structure of the first and second KH domains of human poly-C binding protein-2 reveals insights into its regulatory mechanisms To be Published
|
|
2L8L
| |
8GS8
| cryo-EM structure of the human respiratory complex II | Descriptor: | (1S)-2-{[(2-AMINOETHOXY)(HYDROXY)PHOSPHORYL]OXY}-1-[(PALMITOYLOXY)METHYL]ETHYL STEARATE, FE2/S2 (INORGANIC) CLUSTER, FE3-S4 CLUSTER, ... | Authors: | Du, Z, Zhou, X, Lai, Y, Xu, J, Zhang, Y, Zhou, S, Liu, F, Gao, Y, Gong, H, Rao, Z. | Deposit date: | 2022-09-05 | Release date: | 2023-05-10 | Last modified: | 2024-07-03 | Method: | ELECTRON MICROSCOPY (2.86 Å) | Cite: | Structure of the human respiratory complex II. Proc.Natl.Acad.Sci.USA, 120, 2023
|
|
8IKA
| |
2PY9
| |
5J97
| |
3C4B
| Structure of RNaseIIIb and dsRNA binding domains of mouse Dicer | Descriptor: | Endoribonuclease Dicer | Authors: | Lee, J.K, Du, Z, Tjhen, R.J, Stroud, R.M, James, T.L. | Deposit date: | 2008-01-29 | Release date: | 2008-02-19 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (1.68 Å) | Cite: | Structural and biochemical insights into the dicing mechanism of mouse Dicer: A conserved lysine is critical for dsRNA cleavage. Proc.Natl.Acad.Sci.Usa, 105, 2008
|
|
3C4T
| Structure of RNaseIIIb and dsRNA binding domains of mouse Dicer | Descriptor: | CADMIUM ION, Endoribonuclease Dicer | Authors: | Lee, J.K, Du, Z, Tjhen, R.J, Stroud, R.M, James, T.L. | Deposit date: | 2008-01-30 | Release date: | 2008-02-19 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Structural and biochemical insights into the dicing mechanism of mouse Dicer: A conserved lysine is critical for dsRNA cleavage. Proc.Natl.Acad.Sci.Usa, 105, 2008
|
|
4L9H
| Crystal structure of the FP domain of human F-box protein Fbxo7(SeMet) | Descriptor: | F-box only protein 7 | Authors: | Du, Z, Huang, X, Shang, J, Yang, Y, Wang, G. | Deposit date: | 2013-06-18 | Release date: | 2014-01-15 | Last modified: | 2014-10-08 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Structure of the FP domain of Fbxo7 reveals a novel mode of protein-protein interaction. Acta Crystallogr.,Sect.D, 70, 2014
|
|
4L9C
| Crystal structure of the FP domain of human F-box protein Fbxo7 (native) | Descriptor: | F-box only protein 7, GLYCEROL | Authors: | Du, Z, Huang, X, Shang, J, Yang, Y, Wang, G. | Deposit date: | 2013-06-18 | Release date: | 2014-01-15 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Structure of the FP domain of Fbxo7 reveals a novel mode of protein-protein interaction. Acta Crystallogr.,Sect.D, 70, 2014
|
|
4HNM
| Crystal structure of human catenin-beta-like 1 56 kDa fragment | Descriptor: | Beta-catenin-like protein 1 | Authors: | Du, Z, Huang, X, Wang, G, Wu, Y. | Deposit date: | 2012-10-19 | Release date: | 2013-07-31 | Last modified: | 2024-10-16 | Method: | X-RAY DIFFRACTION (2.9001 Å) | Cite: | The structure of full-length human CTNNBL1 reveals a distinct member of the armadillo-repeat protein family. Acta Crystallogr.,Sect.D, 69, 2013
|
|
4HM9
| Crystal structure of full-length human catenin-beta-like 1 | Descriptor: | Beta-catenin-like protein 1 | Authors: | Du, Z, Huang, X, Wang, G, Wu, Y. | Deposit date: | 2012-10-18 | Release date: | 2013-07-31 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (3.1001 Å) | Cite: | The structure of full-length human CTNNBL1 reveals a distinct member of the armadillo-repeat protein family. Acta Crystallogr.,Sect.D, 69, 2013
|
|
2TPK
| |
1GMY
| Cathepsin B complexed with dipeptidyl nitrile inhibitor | Descriptor: | 2-AMINOETHANIMIDIC ACID, 3-METHYLPHENYLALANINE, CATHEPSIN B, ... | Authors: | Greenspan, P.D, Clark, K.L, Tommasi, R.A, Cowen, S.D, McQuire, L.W, Farley, D.L, van Duzer, J.H, Goldberg, R.L, Zhou, H, Du, Z, Fitt, J.J, Coppa, D.E, Fang, Z, Macchia, W, Zhu, L, Capparelli, M.P, Goldstein, R, Wigg, A.M, Doughty, J.R, Bohacek, R.S, Knap, A.K. | Deposit date: | 2001-09-25 | Release date: | 2002-09-19 | Last modified: | 2017-07-05 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Identification of Dipeptidyl Nitriles as Potent and Selective Inhibitors of Cathepsin B Through Structure-Based Drug Design J.Med.Chem., 44, 2001
|
|
2GM0
| Linear dimer of stemloop SL1 from HIV-1 | Descriptor: | RNA (35-MER) | Authors: | Ulyanov, N.B, Mujeeb, A, Du, Z, Tonelli, M, Parslow, T.G, James, T.L. | Deposit date: | 2006-04-05 | Release date: | 2006-04-25 | Last modified: | 2024-05-29 | Method: | SOLUTION NMR | Cite: | NMR Structure of the Full-length Linear Dimer of Stem-Loop-1 RNA in the HIV-1 Dimer Initiation Site. J.Biol.Chem., 281, 2006
|
|
4WBE
| |
4WBP
| |
2P2R
| Crystal structure of the third KH domain of human Poly(C)-Binding Protein-2 in complex with C-rich strand of human telomeric DNA | Descriptor: | 6-AMINOPYRIMIDIN-2(1H)-ONE, C-rich strand of human telomeric DNA, Poly(rC)-binding protein 2 | Authors: | James, T.L, Stroud, R.M, Du, Z, Fenn, S, Tjhen, R, Lee, J.K. | Deposit date: | 2007-03-07 | Release date: | 2007-06-12 | Last modified: | 2024-10-30 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Crystal structure of the third KH domain of human poly(C)-binding protein-2 in complex with a C-rich strand of human telomeric DNA at 1.6 A resolution. Nucleic Acids Res., 35, 2007
|
|
4NLH
| |