4WQF
 
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with elongation factor G and fusidic acid in the post-translocational state | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Lin, J, Gagnon, M.G, Steitz, T.A. | | Deposit date: | 2014-10-21 | | Release date: | 2015-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Conformational Changes of Elongation Factor G on the Ribosome during tRNA Translocation.
Cell, 160, 2015
|
|
4WPO
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with elongation factor G in the pre-translocational state | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Lin, J, Gagnon, M.G, Steitz, T.A. | | Deposit date: | 2014-10-20 | | Release date: | 2015-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Conformational Changes of Elongation Factor G on the Ribosome during tRNA Translocation.
Cell, 160, 2015
|
|
4WQU
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with elongation factor G trapped by the antibiotic dityromycin | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Lin, J, Gagnon, M.G, Steitz, T.A. | | Deposit date: | 2014-10-22 | | Release date: | 2015-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Conformational Changes of Elongation Factor G on the Ribosome during tRNA Translocation.
Cell, 160, 2015
|
|
4WQY
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with elongation factor G in the post-translocational state (without fusitic acid) | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Lin, J, Gagnon, M.G, Steitz, T.A. | | Deposit date: | 2014-10-22 | | Release date: | 2015-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Conformational Changes of Elongation Factor G on the Ribosome during tRNA Translocation.
Cell, 160, 2015
|
|
3HL2
 | | The crystal structure of the human SepSecS-tRNASec complex | | Descriptor: | (5-HYDROXY-4,6-DIMETHYLPYRIDIN-3-YL)METHYL DIHYDROGEN PHOSPHATE, Monothiophosphate, O-phosphoseryl-tRNA(Sec) selenium transferase, ... | | Authors: | Palioura, S, Steitz, T.A, Soll, D, Simonovic, M. | | Deposit date: | 2009-05-26 | | Release date: | 2009-10-06 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.81 Å) | | Cite: | The human SepSecS-tRNASec complex reveals the mechanism of selenocysteine formation.
Science, 325, 2009
|
|
3I55
 | | Co-crystal structure of Mycalamide A Bound to the Large Ribosomal Subunit | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10E, 50S ribosomal protein L10e, ... | | Authors: | Gurel, G, Blaha, G, Steitz, T.A, Moore, P.B. | | Deposit date: | 2009-07-03 | | Release date: | 2010-03-09 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3.11 Å) | | Cite: | Structures of triacetyloleandomycin and mycalamide A bind to the large ribosomal subunit of Haloarcula marismortui.
Antimicrob.Agents Chemother., 53, 2009
|
|
3I56
 | | Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal Subunit | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10E, 50S ribosomal protein L10e, ... | | Authors: | Gurel, G, Blaha, G, Steitz, T.A, Moore, P.B. | | Deposit date: | 2009-07-03 | | Release date: | 2010-03-09 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structures of triacetyloleandomycin and mycalamide A bind to the large ribosomal subunit of Haloarcula marismortui.
Antimicrob.Agents Chemother., 53, 2009
|
|
3J4J
 | | Model of full-length T. thermophilus Translation Initiation Factor 2 refined against its cryo-EM density from a 30S Initiation Complex map | | Descriptor: | Translation initiation factor IF-2 | | Authors: | Simonetti, A, Marzi, S, Billas, I.M.L, Tsai, A, Fabbretti, A, Myasnikov, A, Roblin, P, Vaiana, A.C, Hazemann, I, Eiler, D, Steitz, T.A, Puglisi, J.D, Gualerzi, C.O, Klaholz, B.P. | | Deposit date: | 2013-08-26 | | Release date: | 2013-09-25 | | Last modified: | 2024-02-21 | | Method: | ELECTRON MICROSCOPY (11.5 Å) | | Cite: | Involvement of protein IF2 N domain in ribosomal subunit joining revealed from architecture and function of the full-length initiation factor.
Proc.Natl.Acad.Sci.USA, 110, 2013
|
|
397D
 | |
4M4W
 | |
4PCW
 | |
2KFZ
 | | KLENOW FRAGMENT WITH BRIDGING-SULFUR SUBSTRATE AND ZINC ONLY | | Descriptor: | 5'-D(*GP*CP*TP*TP*AP*(US1)P*G)-3', KLENOW FRAGMENT OF DNA POLYMERASE I, MAGNESIUM ION, ... | | Authors: | Brautigam, C.A, Sun, S, Piccirilli, J.A, Steitz, T.A. | | Deposit date: | 1998-07-02 | | Release date: | 1998-11-11 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.03 Å) | | Cite: | Structures of normal single-stranded DNA and deoxyribo-3'-S-phosphorothiolates bound to the 3'-5' exonucleolytic active site of DNA polymerase I from Escherichia coli.
Biochemistry, 38, 1999
|
|
2KFN
 | | KLENOW FRAGMENT WITH BRIDGING-SULFUR SUBSTRATE AND MANGANESE | | Descriptor: | 5'-D(*GP*CP*TP*TP*AP*(US1)P*G)-3', KLENOW FRAGMENT OF DNA POLYMERASE I, MAGNESIUM ION, ... | | Authors: | Brautigam, C.A, Sun, S, Piccirilli, J.A, Steitz, T.A. | | Deposit date: | 1998-07-01 | | Release date: | 1998-11-11 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.03 Å) | | Cite: | Structures of normal single-stranded DNA and deoxyribo-3'-S-phosphorothiolates bound to the 3'-5' exonucleolytic active site of DNA polymerase I from Escherichia coli.
Biochemistry, 38, 1999
|
|
4Q6G
 | | Crystal Structure of the C-terminal domain of AcKRS-1 bound with N-acetyl-lysine and ADPNP | | Descriptor: | 1,2-ETHANEDIOL, N(6)-ACETYLLYSINE, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER, ... | | Authors: | Eiler, D.R, Kavran, J, Steitz, T.A. | | Deposit date: | 2014-04-22 | | Release date: | 2014-11-12 | | Last modified: | 2023-12-06 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | Polyspecific pyrrolysyl-tRNA synthetases from directed evolution.
Proc.Natl.Acad.Sci.USA, 111, 2014
|
|
2KZZ
 | | KLENOW FRAGMENT WITH NORMAL SUBSTRATE AND ZINC ONLY | | Descriptor: | DNA (5'-D(*GP*CP*TP*T*AP*CP*G)-3'), PROTEIN (DNA POLYMERASE I), ZINC ION | | Authors: | Brautigam, C.A, Sun, S, Piccirilli, J.A, Steitz, T.A. | | Deposit date: | 1998-07-07 | | Release date: | 1999-12-14 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | Structures of normal single-stranded DNA and deoxyribo-3'-S-phosphorothiolates bound to the 3'-5' exonucleolytic active site of DNA polymerase I from Escherichia coli.
Biochemistry, 38, 1999
|
|
4QJH
 | |
4QJD
 | |
2KZM
 | | KLENOW FRAGMENT WITH NORMAL SUBSTRATE AND ZINC AND MANGANESE | | Descriptor: | DNA (5'-D(*GP*CP*TP*TP*A*CP*GP*C)-3'), MANGANESE (II) ION, PROTEIN (DNA POLYMERASE I), ... | | Authors: | Brautigam, C.A, Sun, S, Piccirilli, J.A, Steitz, T.A. | | Deposit date: | 1998-07-03 | | Release date: | 1999-02-16 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structures of normal single-stranded DNA and deoxyribo-3'-S-phosphorothiolates bound to the 3'-5' exonucleolytic active site of DNA polymerase I from Escherichia coli.
Biochemistry, 38, 1999
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1GSG
 | | Structure of E.coli glutaminyl-tRNA synthetase complexed with trnagln and ATP at 2.8 Angstroms resolution | | Descriptor: | GLUTAMINYL-TRNA SYNTHETASE, TRNAGLN | | Authors: | Rould, M.A, Perona, J.J, Soell, D, Steitz, T.A. | | Deposit date: | 1990-04-03 | | Release date: | 1992-02-24 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structure of E. coli glutaminyl-tRNA synthetase complexed with tRNA(Gln) and ATP at 2.8 A resolution.
Science, 246, 1989
|
|
4S20
 | | Structural basis for transcription reactivation by RapA | | Descriptor: | 5'-D(P*AP*CP*GP*AP*CP*TP*GP*AP*GP*CP*CP*GP*AP*TP*G)-3', 5'-R(P*AP*UP*CP*GP*GP*CP*UP*CP*A)-3', DNA-directed RNA polymerase subunit alpha, ... | | Authors: | Liu, B, Zuo, Y, Steitz, T.A. | | Deposit date: | 2015-01-16 | | Release date: | 2015-02-04 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (4.7 Å) | | Cite: | Structural basis for transcription reactivation by RapA.
Proc.Natl.Acad.Sci.USA, 112, 2015
|
|
4V5H
 | | E.Coli 70s Ribosome Stalled During Translation Of Tnac Leader Peptide. | | Descriptor: | 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S10, ... | | Authors: | Seidelt, B, Innis, C.A, Wilson, D.N, Gartmann, M, Armache, J, Villa, E, Trabuco, L.G, Becker, T, Mielke, T, Schulten, K, Steitz, T.A, Beckmann, R. | | Deposit date: | 2009-10-26 | | Release date: | 2014-07-09 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (5.8 Å) | | Cite: | Structural insight into nascent polypeptide chain-mediated translational stalling.
Science, 326, 2009
|
|
4V7W
 | | Structure of the Thermus thermophilus ribosome complexed with chloramphenicol. | | Descriptor: | 16S rRNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Bulkley, D.P, Innis, C.A, Blaha, G, Steitz, T.A. | | Deposit date: | 2010-08-16 | | Release date: | 2014-07-09 | | Last modified: | 2014-12-10 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Revisiting the structures of several antibiotics bound to the bacterial ribosome.
Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
4W2I
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with negamycin, mRNA and three deacylated tRNAs in the A, P and E sites | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S Ribosomal Protein S10, ... | | Authors: | Polikanov, Y.S, Szal, T, Jiang, F, Gupta, P, Matsuda, R, Shiozuka, M, Steitz, T.A, Vazquez-Laslop, N, Mankin, A.S. | | Deposit date: | 2014-09-12 | | Release date: | 2014-10-15 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Negamycin Interferes with Decoding and Translocation by Simultaneous Interaction with rRNA and tRNA.
Mol.Cell, 56, 2014
|
|
