1C04
| IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI | Descriptor: | 23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L11, RIBOSOMAL PROTEIN L14, ... | Authors: | Ban, N, Nissen, P, Capel, M, Moore, P.B, Steitz, T.A. | Deposit date: | 1999-07-14 | Release date: | 1999-08-31 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (5 Å) | Cite: | Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit. Nature, 400, 1999
|
|
1FFZ
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1FFK
| CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-25 | Release date: | 2000-08-14 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution. Science, 289, 2000
|
|
1FG0
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
3IKA
| |
4QQC
| Crystal Structure of FGF Receptor (FGFR) 4 Kinase Domain in Complex with FIIN-2, an Irreversible Tyrosine Kinase Inhibitor Capable of Overcoming FGFR Kinase Gate-Keeper Mutations | Descriptor: | Fibroblast growth factor receptor 4, N-(4-{[3-(3,5-dimethoxyphenyl)-7-{[4-(4-methylpiperazin-1-yl)phenyl]amino}-2-oxo-3,4-dihydropyrimido[4,5-d]pyrimidin-1(2H)-yl]methyl}phenyl)propanamide, SULFATE ION | Authors: | Huang, Z, Mohammadi, M. | Deposit date: | 2014-06-27 | Release date: | 2014-10-29 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Development of covalent inhibitors that can overcome resistance to first-generation FGFR kinase inhibitors. Proc.Natl.Acad.Sci.USA, 111, 2014
|
|
4R6V
| Crystal Structure of FGF Receptor (FGFR) 4 Kinase Harboring the V550L Gate-Keeper Mutation in Complex with FIIN-3, an Irreversible Tyrosine Kinase Inhibitor Capable of Overcoming FGFR kinase Gate-Keeper Mutations | Descriptor: | Fibroblast growth factor receptor 4, N-[4-({[(2,6-dichloro-3,5-dimethoxyphenyl)carbamoyl](6-{[4-(4-methylpiperazin-1-yl)phenyl]amino}pyrimidin-4-yl)amino}methyl)phenyl]propanamide, SULFATE ION | Authors: | Huang, Z, Mohammadi, M. | Deposit date: | 2014-08-26 | Release date: | 2014-10-29 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.353 Å) | Cite: | Development of covalent inhibitors that can overcome resistance to first-generation FGFR kinase inhibitors. Proc.Natl.Acad.Sci.USA, 111, 2014
|
|
4R5S
| Crystal structure of EGFR 696-1022 L858R in complex with FIIN-3 | Descriptor: | Epidermal growth factor receptor, N-[4-({[(2,6-dichloro-3,5-dimethoxyphenyl)carbamoyl](6-{[4-(4-methylpiperazin-1-yl)phenyl]amino}pyrimidin-4-yl)amino}methyl)phenyl]propanamide | Authors: | Zhu, S.J, Yun, C.H. | Deposit date: | 2014-08-22 | Release date: | 2014-11-12 | Last modified: | 2022-08-24 | Method: | X-RAY DIFFRACTION (3.001 Å) | Cite: | Development of covalent inhibitors that can overcome resistance to first-generation FGFR kinase inhibitors. Proc.Natl.Acad.Sci.USA, 111, 2014
|
|