2YPF
 
 | | Structure of the AvrBs3-DNA complex provides new insights into the initial thymine-recognition mechanism | | Descriptor: | 5'-D(*TP*AP*GP*AP*GP*GP*GP*TP*TP*AP*GP*GP*TP*TP *TP*AP*TP*AP*TP*AP*AP)-3', 5'-D(*TP*TP*TP*AP*TP*AP*TP*AP*AP*AP*CP*CP*TP*AP *AP*CP*CP*CP*TP*CP*TP*AP)-3', AVRBS3 | | Authors: | Stella, S, Molina, R, Yefimenko, I, Prieto, J, Silva, G.H, Bertonati, C, Juillerat, A, Duchateau, P, Montoya, G. | | Deposit date: | 2012-10-30 | | Release date: | 2013-08-28 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.55 Å) | | Cite: | Structure of the Avrbs3-DNA Complex Provides New Insights Into the Initial Thymine-Recognition Mechanism
Acta Crystallogr.,Sect.D, 69, 2013
|
|
4CJ9
 | | BurrH DNA-binding protein from Burkholderia rhizoxinica in its apo form | | Descriptor: | BURRH, SELENIUM ATOM | | Authors: | Stella, S, Molina, R, Lopez-Mendez, B, Campos-Olivas, R, Duchateau, P, Montoya, G. | | Deposit date: | 2013-12-19 | | Release date: | 2014-07-09 | | Last modified: | 2014-07-23 | | Method: | X-RAY DIFFRACTION (2.214 Å) | | Cite: | Bud, a Helix-Loop-Helix DNA-Binding Domain for Genome Modification
Acta Crystallogr.,Sect.D, 70, 2014
|
|
4CJA
 | | BurrH DNA-binding protein from Burkholderia rhizoxinica in complex with its target DNA | | Descriptor: | 5'-D(*DTP*AP*TP*AP*AP*CP*GP*TP*AP*TP*TP*TP*GP*CP *TP*TP*CP*TP*CP*TP*TP*AP*AP)-3', 5'-D(*DTP*TP*AP*AP*GP*AP*GP*AP*AP*GP*CP*AP*AP*DP *TP*AP*CP*GP*TP*TP*AP*TP*AP)-3', BURRH | | Authors: | Stella, S, Molina, R, Lopez-Mendez, B, Campos-Olivas, R, Duchateau, P, Montoya, G. | | Deposit date: | 2013-12-19 | | Release date: | 2014-07-09 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.651 Å) | | Cite: | Bud, a Helix-Loop-Helix DNA-Binding Domain for Genome Modification
Acta Crystallogr.,Sect.D, 70, 2014
|
|
3IV5
 | |
3JR9
 | |
3JRF
 | |
3JRD
 | |
3JRB
 | |
3JRH
 | |
3JRA
 | |
3JRG
 | |
3JRC
 | |
3JRI
 | |
3JRE
 | |
5MGA
 | |
6GTE
 | | Transient state structure of CRISPR-Cpf1 (Cas12a) I3 conformation | | Descriptor: | CRISPR-associated endonuclease Cas12a, DNA (5'-D(P*AP*TP*GP*AP*CP*TP*TP*CP*TP*CP*TP*AP*AP*CP*AP*AP*GP*CP*TP*CP*G)-3'), DNA (5'-D(P*CP*GP*AP*GP*CP*TP*CP*GP*TP*TP*AP*GP*AP*GP*AP*AP*G)-3'), ... | | Authors: | Montoya, G, Mesa, P, Stella, S. | | Deposit date: | 2018-06-18 | | Release date: | 2018-12-19 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (4.07 Å) | | Cite: | Conformational Activation Promotes CRISPR-Cas12a Catalysis and Resetting of the Endonuclease Activity.
Cell, 175, 2018
|
|
6GTG
 | | Transition state structure of Cpf1(Cas12a) I4 conformation | | Descriptor: | CRISPR-associated endonuclease Cas12a, DNA (32-MER), DNA (5'-D(P*CP*GP*AP*GP*CP*TP*CP*GP*TP*TP*AP*GP*AP*GP*AP*AP*GP*T)-3'), ... | | Authors: | Mesa, P, Montoya, G, Stella, S. | | Deposit date: | 2018-06-18 | | Release date: | 2018-12-19 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (3.27 Å) | | Cite: | Conformational Activation Promotes CRISPR-Cas12a Catalysis and Resetting of the Endonuclease Activity.
Cell, 175, 2018
|
|
6GTF
 | | Transient state structure of CRISPR-Cpf1 (Cas12a) I5 conformation | | Descriptor: | CRISPR-associated endonuclease Cas12a, DNA (5'-D(P*AP*TP*GP*AP*CP*TP*TP*CP*TP*CP*TP*AP*AP*CP*AP*AP*GP*CP*TP*CP*G)-3'), DNA (5'-D(P*CP*GP*AP*GP*CP*TP*CP*GP*TP*TP*AP*GP*AP*GP*AP*A)-3'), ... | | Authors: | Montoya, G, Mesa, P, Stella, S. | | Deposit date: | 2018-06-18 | | Release date: | 2018-12-19 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (3.63 Å) | | Cite: | Conformational Activation Promotes CRISPR-Cas12a Catalysis and Resetting of the Endonuclease Activity.
Cell, 175, 2018
|
|
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
6R9R
 | | Crystal structure of Csx1 in complex with cyclic oligoadenylate cOA4 conformation 2 | | Descriptor: | CRISPR-associated (Cas) DxTHG family, circular RNA (5'-R(P*AP*AP*AP*A)-3') | | Authors: | Molina, R, Montoya, G, Sofos, N, Stella, S. | | Deposit date: | 2019-04-03 | | Release date: | 2019-10-02 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Structure of Csx1-cOA4complex reveals the basis of RNA decay in Type III-B CRISPR-Cas.
Nat Commun, 10, 2019
|
|
6R7B
 | | Crystal structure of Csx1 in complex with cyclic oligoadenylate cOA4 conformation 1 | | Descriptor: | CRISPR-associated (Cas) DxTHG family, RNA (5'-R(P*AP*AP*AP*A)-3') | | Authors: | Molina, R, Montoya, G, Sofos, N, Stella, S. | | Deposit date: | 2019-03-28 | | Release date: | 2019-10-02 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (3.12 Å) | | Cite: | Structure of Csx1-cOA4complex reveals the basis of RNA decay in Type III-B CRISPR-Cas.
Nat Commun, 10, 2019
|
|
4UT0
 | | THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 10 DAYS INCUBATION IN 5MM MN (STATE 7) | | Descriptor: | 5'-D(*CP*CP*GP*GP*CP*AP*AP*GP*GP*CP)-3', 5'-D(*CP*GP*CP*GP*CP*CP*GP*GP*AP*AP*CP*TP*TP*AP*CP)-3', 5'-D(*GP*CP*CP*TP*TP*GP*CP*CP*GP*GP*GP*TP*AP*AP)-3', ... | | Authors: | Molina, R, Stella, S, Redondo, P, Gomez, H, Marcaida, M.J, Orozco, M, Prieto, J, Montoya, G. | | Deposit date: | 2014-07-17 | | Release date: | 2014-12-17 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
|
|
7Z56
 | | Crystal Structure of the Ring Nuclease 0455 from Sulfolobus islandicus (Sis0455) in its apo form | | Descriptor: | CRISPR-associated protein | | Authors: | Molina, R, Martin-Garcia, R, Lopez-Mendez, B, Jensen, A.L.G, Marchena-Hurtado, J, Stella, S, Montoya, G. | | Deposit date: | 2022-03-08 | | Release date: | 2022-11-23 | | Last modified: | 2024-01-31 | | Method: | X-RAY DIFFRACTION (2.27 Å) | | Cite: | Molecular basis of cyclic tetra-oligoadenylate processing by small standalone CRISPR-Cas ring nucleases.
Nucleic Acids Res., 50, 2022
|
|
7Z55
 | | Crystal Structure of the Ring Nuclease 0455 from Sulfolobus islandicus (Sis0455) in complex with its substrate | | Descriptor: | ACETATE ION, CRISPR-associated protein, Cyclic RNA cA4, ... | | Authors: | Molina, R, Martin-Garcia, R, Lopez-Mendez, B, Jensen, A.L.G, Marchena-Hurtado, J, Stella, S, Montoya, G. | | Deposit date: | 2022-03-08 | | Release date: | 2022-11-23 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (1.664 Å) | | Cite: | Molecular basis of cyclic tetra-oligoadenylate processing by small standalone CRISPR-Cas ring nucleases.
Nucleic Acids Res., 50, 2022
|
|
7ODF
 | | Structure of the mini-RNA-guided endonuclease CRISPR-Cas_phi3 | | Descriptor: | Cas_phi3, DNA (5'-D(P*GP*G)-3'), DNA (5'-D(P*GP*TP*AP*AP*TP*TP*CP*AP*G)-3'), ... | | Authors: | Carabias del Rey, A, Fugilsang, A, Temperini, P, Pape, T, Sofos, N, Stella, S, Erledsson, S, Montoya, G. | | Deposit date: | 2021-04-29 | | Release date: | 2021-07-21 | | Last modified: | 2021-08-11 | | Method: | ELECTRON MICROSCOPY (2.7 Å) | | Cite: | Structure of the mini-RNA-guided endonuclease CRISPR-Cas12j3.
Nat Commun, 12, 2021
|
|
