5LFQ
| Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis (space group P3) | Descriptor: | Bacterial proteasome activator | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | Deposit date: | 2016-07-04 | Release date: | 2016-11-23 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.503 Å) | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome. Structure, 24, 2016
|
|
1K8A
| Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T. | Deposit date: | 2001-10-23 | Release date: | 2002-07-19 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit. Mol.Cell, 10, 2002
|
|
1FG0
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
4B0S
| Structure of the Deamidase-Depupylase Dop of the Prokaryotic Ubiquitin-like Modification Pathway in Complex with ATP | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, DEAMIDASE-DEPUPYLASE DOP, MAGNESIUM ION | Authors: | Ozcelik, D, Barandun, J, Schmitz, N, Sutter, M, Guth, E, Damberger, F.F, Allain, F.H.-T, Ban, N, Weber-Ban, E. | Deposit date: | 2012-07-04 | Release date: | 2012-09-12 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.85 Å) | Cite: | Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway. Nat.Commun., 3, 2012
|
|
4B0R
| Structure of the Deamidase-Depupylase Dop of the Prokaryotic Ubiquitin-like Modification Pathway | Descriptor: | DEAMIDASE-DEPUPYLASE DOP | Authors: | Ozcelik, D, Barandun, J, Schmitz, N, Sutter, M, Guth, E, Damberger, F.F, Allain, F.H.-T, Ban, N, Weber-Ban, E. | Deposit date: | 2012-07-04 | Release date: | 2012-09-12 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structures of Pup ligase PafA and depupylase Dop from the prokaryotic ubiquitin-like modification pathway. Nat Commun, 3, 2012
|
|
4B0T
| Structure of the Pup Ligase PafA of the Prokaryotic Ubiquitin-like Modification Pathway in Complex with ADP | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, PUP--PROTEIN LIGASE | Authors: | Ozcelik, D, Barandun, J, Schmitz, N, Sutter, M, Guth, E, Damberger, F.F, Allain, F.H.-T, Ban, N, Weber-Ban, E. | Deposit date: | 2012-07-04 | Release date: | 2012-09-12 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.159 Å) | Cite: | Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway. Nat.Commun., 3, 2012
|
|
1FFZ
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
5A2Q
| Structure of the HCV IRES bound to the human ribosome | Descriptor: | 18S RRNA, HCV IRES, MAGNESIUM ION, ... | Authors: | Quade, N, Leiundgut, M, Boehringer, D, Heuvel, J.v.d, Ban, N. | Deposit date: | 2015-05-21 | Release date: | 2015-07-15 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (3.9 Å) | Cite: | Cryo-Em Structure of Hepatitis C Virus Ires Bound to the Human Ribosome at 3.9 Angstrom Resolution Nat.Commun., 6, 2015
|
|
4V19
| Structure of the large subunit of the mammalian mitoribosome, part 1 of 2 | Descriptor: | MAGNESIUM ION, MITORIBOSOMAL 16S RRNA, MITORIBOSOMAL CP TRNA, ... | Authors: | Greber, B.J, Boehringer, D, Leibundgut, M, Bieri, P, Leitner, A, Schmitz, N, Aebersold, R, Ban, N. | Deposit date: | 2014-09-25 | Release date: | 2014-10-08 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (3.4 Å) | Cite: | The Complete Structure of the Large Subunit of the Mammalian Mitochondrial Ribosome Nature, 515, 2014
|
|
3MF1
| Crystal structure of class II aaRS homologue (Bll0957) complexed with an analogue of glycyl adenylate | Descriptor: | 5'-O-(glycylsulfamoyl)adenosine, Bll0957 protein, ZINC ION | Authors: | Weygand-Durasevic, I, Mocibob, M, Ivic, N, Bilokapic, S, Maier, T, Luic, M, Ban, N. | Deposit date: | 2010-04-01 | Release date: | 2010-07-28 | Last modified: | 2017-11-08 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Homologs of aminoacyl-tRNA synthetases acylate carrier proteins and provide a link between ribosomal and nonribosomal peptide synthesis Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
7NSH
| 39S mammalian mitochondrial large ribosomal subunit with mtRRF (post) and mtEFG2 | Descriptor: | 16S rRNA, 39S ribosomal protein L48, mitochondrial, ... | Authors: | Kummer, E, Schubert, K, Ban, N. | Deposit date: | 2021-03-07 | Release date: | 2021-05-05 | Last modified: | 2024-07-10 | Method: | ELECTRON MICROSCOPY (3.2 Å) | Cite: | Structural basis of translation termination, rescue, and recycling in mammalian mitochondria. Mol.Cell, 81, 2021
|
|
7NQL
| 55S mammalian mitochondrial ribosome with ICT1 and P site tRNAMet | Descriptor: | 12S rRNA, 16S rRNA, 28S ribosomal protein S16, ... | Authors: | Kummer, E, Schubert, K, Ban, N. | Deposit date: | 2021-03-01 | Release date: | 2021-05-05 | Last modified: | 2021-12-15 | Method: | ELECTRON MICROSCOPY (3.4 Å) | Cite: | Structural basis of translation termination, rescue, and recycling in mammalian mitochondria. Mol.Cell, 81, 2021
|
|
7NQH
| 55S mammalian mitochondrial ribosome with mtRF1a and P-site tRNAMet | Descriptor: | 12S rRNA, 16S rRNA, 28S ribosomal protein S16, ... | Authors: | Kummer, E, Schubert, K, Ban, N. | Deposit date: | 2021-03-01 | Release date: | 2021-05-05 | Last modified: | 2024-10-16 | Method: | ELECTRON MICROSCOPY (3.5 Å) | Cite: | Structural basis of translation termination, rescue, and recycling in mammalian mitochondria. Mol.Cell, 81, 2021
|
|
7NSJ
| 55S mammalian mitochondrial ribosome with tRNA(P/P) and tRNA(E*) | Descriptor: | 12S rRNA, 16S rRNA, 28S ribosomal protein S16, ... | Authors: | Kummer, E, Schubert, K, Ban, N. | Deposit date: | 2021-03-07 | Release date: | 2021-06-02 | Last modified: | 2024-10-09 | Method: | ELECTRON MICROSCOPY (3.9 Å) | Cite: | Structural basis of translation termination, rescue, and recycling in mammalian mitochondria. Mol.Cell, 81, 2021
|
|
7O7Z
| Rabbit 80S ribosome stalled close to the mutated SARS-CoV-2 slippery site by a pseudoknot (classified for pseudoknot) | Descriptor: | 18S rRNA, 28S rRNA, 40S ribosomal protein S11, ... | Authors: | Bhatt, P.R, Scaiola, A, Leibundgut, M.A, Atkins, J.F, Ban, N. | Deposit date: | 2021-04-14 | Release date: | 2021-06-02 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (2.4 Å) | Cite: | Structural basis of ribosomal frameshifting during translation of the SARS-CoV-2 RNA genome. Science, 372, 2021
|
|
7O81
| Rabbit 80S ribosome colliding in another ribosome stalled by the SARS-CoV-2 pseudoknot | Descriptor: | 18S rRNA, 28S rRNA, 40S ribosomal protein S11, ... | Authors: | Bhatt, P.R, Scaiola, A, Leibundgut, M.A, Atkins, J.F, Ban, N. | Deposit date: | 2021-04-14 | Release date: | 2021-06-02 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (3.1 Å) | Cite: | Structural basis of ribosomal frameshifting during translation of the SARS-CoV-2 RNA genome. Science, 372, 2021
|
|
7NSI
| 55S mammalian mitochondrial ribosome with mtRRF (pre) and tRNA(P/E) | Descriptor: | 12S rRNA, 16S rRNA, 28S ribosomal protein S10, ... | Authors: | Kummer, E, Schubert, K, Ban, N. | Deposit date: | 2021-03-07 | Release date: | 2021-06-02 | Last modified: | 2021-12-15 | Method: | ELECTRON MICROSCOPY (4.6 Å) | Cite: | Structural basis of translation termination, rescue, and recycling in mammalian mitochondria. Mol.Cell, 81, 2021
|
|
7O80
| Rabbit 80S ribosome in complex with eRF1 and ABCE1 stalled at the STOP codon in the mutated SARS-CoV-2 slippery site | Descriptor: | 18S rRNA, 28S rRNA, 40S ribosomal protein S11, ... | Authors: | Bhatt, P.R, Scaiola, A, Leibundgut, M.A, Atkins, J.F, Ban, N. | Deposit date: | 2021-04-14 | Release date: | 2021-06-02 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (2.9 Å) | Cite: | Structural basis of ribosomal frameshifting during translation of the SARS-CoV-2 RNA genome. Science, 372, 2021
|
|
7O7Y
| Rabbit 80S ribosome stalled close to the mutated SARS-CoV-2 slippery site by a pseudoknot (high resolution) | Descriptor: | 18S rRNA, 28S rRNA, 40S ribosomal protein S11, ... | Authors: | Bhatt, P.R, Scaiola, A, Leibundgut, M.A, Atkins, J.F, Ban, N. | Deposit date: | 2021-04-14 | Release date: | 2021-06-02 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (2.2 Å) | Cite: | Structural basis of ribosomal frameshifting during translation of the SARS-CoV-2 RNA genome. Science, 372, 2021
|
|
7O5H
| Ribosomal methyltransferase KsgA bound to small ribosomal subunit | Descriptor: | 16S rRNA, 30S ribosomal protein S11, 30S ribosomal protein S12, ... | Authors: | Stephan, N.C, Ries, A.B, Boehringer, D, Ban, N. | Deposit date: | 2021-04-08 | Release date: | 2021-06-16 | Last modified: | 2024-07-10 | Method: | ELECTRON MICROSCOPY (3.1 Å) | Cite: | Structural basis of successive adenosine modifications by the conserved ribosomal methyltransferase KsgA. Nucleic Acids Res., 49, 2021
|
|
7ODS
| State B of the human mitoribosomal large subunit assembly intermediate | Descriptor: | 16S mitochondrial rRNA, DNA (30-MER),16S mitochondrial rRNA, 39S ribosomal protein L10, ... | Authors: | Lenarcic, T, Jaskolowski, M, Leibundgut, M, Scaiola, A, Schoenhut, T, Saurer, M, Lee, R.G, Rackham, O, Filipovska, A, Ban, N. | Deposit date: | 2021-04-30 | Release date: | 2021-06-23 | Last modified: | 2023-11-15 | Method: | ELECTRON MICROSCOPY (3.1 Å) | Cite: | Stepwise maturation of the peptidyl transferase region of human mitoribosomes. Nat Commun, 12, 2021
|
|
7ODR
| State A of the human mitoribosomal large subunit assembly intermediate | Descriptor: | 16S mitochondrial rRNA, DNA (31-MER),16S mitochondrial rRNA, 39S ribosomal protein L10, ... | Authors: | Lenarcic, T, Jaskolowski, M, Leibundgut, M, Scaiola, A, Schoenhut, T, Saurer, M, Lee, R.G, Rackham, O, Filipovska, A, Ban, N. | Deposit date: | 2021-04-30 | Release date: | 2021-06-23 | Last modified: | 2023-11-15 | Method: | ELECTRON MICROSCOPY (2.9 Å) | Cite: | Stepwise maturation of the peptidyl transferase region of human mitoribosomes. Nat Commun, 12, 2021
|
|
7ODT
| State C of the human mitoribosomal large subunit assembly intermediate | Descriptor: | 16S mitochondrial rRNA, 39S ribosomal protein L10, mitochondrial, ... | Authors: | Lenarcic, T, Jaskolowski, M, Leibundgut, M, Scaiola, A, Schoenhut, T, Saurer, M, Lee, R.G, Rackham, O, Filipovska, A, Ban, N. | Deposit date: | 2021-04-30 | Release date: | 2021-06-23 | Last modified: | 2023-11-15 | Method: | ELECTRON MICROSCOPY (3.1 Å) | Cite: | Stepwise maturation of the peptidyl transferase region of human mitoribosomes. Nat Commun, 12, 2021
|
|
4U1F
| |
4UER
| 40S-eIF1-eIF1A-eIF3-eIF3j translation initiation complex from Lachancea kluyveri | Descriptor: | 18S RRNA, EIF1, EIF1A, ... | Authors: | Aylett, C.H.S, Boehringer, D, Erzberger, J.P, Schaefer, T, Ban, N. | Deposit date: | 2014-12-18 | Release date: | 2015-02-11 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (6.47 Å) | Cite: | Structure of a Yeast 40S-Eif1-Eif1A-Eif3-Eif3J Initiation Complex Nat.Struct.Mol.Biol., 22, 2015
|
|