2GLR
| |
3N6S
| Crystal structure of human mitochondrial mTERF in complex with a 15-mer DNA encompassing the tRNALeu(UUR) binding sequence | Descriptor: | DNA (5'-D(*AP*TP*GP*GP*CP*AP*GP*AP*GP*CP*CP*CP*GP*GP*T)-3'), DNA (5'-D(*TP*AP*CP*CP*GP*GP*GP*CP*TP*CP*TP*GP*CP*CP*A)-3'), Transcription termination factor, ... | Authors: | Jimenez-Menendez, N, Fernandez-Millan, P, Rubio-Cosials, A, Arnan, C, Montoya, J, Jacobs, H.T, Bernado, P, Coll, M, Uson, I, Sola, M. | Deposit date: | 2010-05-26 | Release date: | 2010-06-16 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Human mitochondrial mTERF wraps around DNA through a left-handed superhelical tandem repeat. Nat.Struct.Mol.Biol., 17, 2010
|
|
1EA4
| TRANSCRIPTIONAL REPRESSOR COPG/22bp dsDNA COMPLEX | Descriptor: | DNA (5'-D(*TP*AP*AP*CP*CP*GP*TP*GP *CP*AP*CP*TP*CP*AP*AP*TP*GP*CP*AP*AP*TP*C)-3'), DNA(5'-D(*AP*GP*AP*TP*TP*GP*CP*AP*TP *TP*GP*AP*GP*TP*GP*CP*AP*CP*GP*GP*TP*T)-3'), TRANSCRIPTIONAL REPRESSOR COPG | Authors: | Gomis-Rueth, F.X, Costa, M, Sola, M, Acebo, P, Eritja, R, Espinosa, M, Solar, G.D, Coll, M. | Deposit date: | 2000-11-05 | Release date: | 2001-07-05 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.95 Å) | Cite: | Plasmid Transcriptional Repressor Copg Oligomerises to Render Helical Superstructures Unbound and in Complexes with Oligonucleotides J.Mol.Biol., 310, 2001
|
|
1QX0
| CONJUGATIVE RELAXASE TRWC IN COMPLEX WITH ORIT DNA. METAL-BOUND STRUCTURE | Descriptor: | DNA OLIGONUCLEOTIDE, SULFATE ION, ZINC ION, ... | Authors: | Guasch, A, Lucas, M, Moncalian, G, Cabezas, M, Prez-Luque, R, Gomis-Rth, F.X, de la Cruz, F, Coll, M. | Deposit date: | 2003-09-04 | Release date: | 2003-11-25 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.26 Å) | Cite: | RECOGNITION AND PROCESSING OF THE ORIGIN OF TRANSFER DNA BY CONJUGATIVE RELAXASE TRWC Nat.Struct.Biol., 10, 2003
|
|
1K9G
| Crystal Structure of the Complex of Cryptolepine-d(CCTAGG)2 | Descriptor: | 5'-D(*CP*CP*TP*AP*GP*G)-3', 5-METHYL-5H-INDOLO[3,2-B]QUINOLINE | Authors: | Lisgarten, J.N, Coll, M, Portugal, J, Wright, C.W, Aymami, J. | Deposit date: | 2001-10-29 | Release date: | 2001-11-30 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (1.4 Å) | Cite: | The antimalarial and cytotoxic drug cryptolepine intercalates into DNA at cytosine-cytosine sites. Nat.Struct.Biol., 9, 2002
|
|
2CDM
| The structure of TrwC complexed with a 27-mer DNA comprising the recognition hairpin and the cleavage site | Descriptor: | 5'-D(*GP*CP*GP*CP*AP*CP*CP*GP*AP*AP *AP*GP*GP*TP*GP*CP*GP*TP*AP*TP*TP*GP*TP*CP*TP*AP*T)-3', SULFATE ION, TRWC | Authors: | Boer, R, Russi, S, Guasch, A, Lucas, M, Blanco, A.G, Perez-Luque, R, Coll, M, de la Cruz, F. | Deposit date: | 2006-01-25 | Release date: | 2006-07-31 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Unveiling the Molecular Mechanism of a Conjugative Relaxase: The Structure of Trwc Complexed with a 27-mer DNA Comprising the Recognition Hairpin and the Cleavage Site. J.Mol.Biol., 358, 2006
|
|
3ZZJ
| Structure of an engineered aspartate aminotransferase | Descriptor: | ASPARTATE AMINOTRANSFERASE, BETA-MERCAPTOETHANOL, DI(HYDROXYETHYL)ETHER, ... | Authors: | Fernandez, F.J, deVries, D, Pena-Soler, E, Coll, M, Christen, P, Gehring, H, Vega, M.C. | Deposit date: | 2011-09-01 | Release date: | 2011-12-28 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Structure and Mechanism of a Cysteine Sulfinate Desulfinase Engineered on the Aspartate Aminotransferase Scaffold. Biocim.Biophys.Acta, 1824, 2011
|
|
1H8X
| Domain-swapped Dimer of a Human Pancreatic Ribonuclease Variant | Descriptor: | RIBONUCLEASE 1 | Authors: | Canals, A, Pous, J, Guasch, A, Benito, A, Ribo, M, Vilanova, M, Coll, M. | Deposit date: | 2001-02-16 | Release date: | 2002-02-14 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | The Structure of an Engineered Domain-Swapped Ribonuclease Dimer and its Implications for the Evolution of Proteins Toward Oligomerization Structure, 9, 2001
|
|
1KWM
| Human procarboxypeptidase B: Three-dimensional structure and implications for thrombin-activatable fibrinolysis inhibitor (TAFI) | Descriptor: | CITRIC ACID, Procarboxypeptidase B, ZINC ION | Authors: | Pereira, P.J.B, Segura-Martin, S, Ferrer-Orta, C, Vendrell, J, Aviles, F.-X, Coll, M, Gomis-Rueth, F.-X. | Deposit date: | 2002-01-30 | Release date: | 2002-06-05 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Human procarboxypeptidase B: three-dimensional structure and implications for thrombin-activatable fibrinolysis inhibitor (TAFI). J.Mol.Biol., 321, 2002
|
|
3ZZK
| Structure of an engineered aspartate aminotransferase | Descriptor: | 4'-DEOXY-4'-AMINOPYRIDOXAL-5'-PHOSPHATE, ASPARTATE AMINOTRANSFERASE, GLYCEROL, ... | Authors: | Fernandez, F.J, deVries, D, Pena-Soler, E, Coll, M, Christen, P, Gehring, H, Vega, M.C. | Deposit date: | 2011-09-01 | Release date: | 2011-12-28 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (1.78 Å) | Cite: | Structure and Mechanism of a Cysteine Sulfinate Desulfinase Engineered on the Aspartate Aminotransferase Scaffold. Biocim.Biophys.Acta, 1824, 2011
|
|
4LVM
| MobM Relaxase Domain (MOBV; Mob_Pre) bound to plasmid pMV158 oriT DNA (23nt). Mn-bound crystal structure at pH 6.5 | Descriptor: | ACTTTAT oligonucleotide, ATAAAGTATAGTGTGT oligonucleotide, CHLORIDE ION, ... | Authors: | Pluta, R, Boer, D.R, Coll, M. | Deposit date: | 2013-07-26 | Release date: | 2014-09-24 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Structural basis of a histidine-DNA nicking/joining mechanism for gene transfer and promiscuous spread of antibiotic resistance. Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
4LVK
| MobM Relaxase Domain (MOBV; Mob_Pre) bound to plasmid pMV158 oriT DNA (22nt+3'Phosphate). Mn-bound crystal structure at pH 4.6 | Descriptor: | ACTTTAT oligonucleotide, ATAAAGTATAGTGTGpo oligonucleotide, MANGANESE (II) ION, ... | Authors: | Pluta, R, Boer, D.R, Coll, M. | Deposit date: | 2013-07-26 | Release date: | 2014-09-24 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (2.37 Å) | Cite: | Structural basis of a histidine-DNA nicking/joining mechanism for gene transfer and promiscuous spread of antibiotic resistance. Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
3O76
| |
4LVI
| MobM Relaxase Domain (MOBV; Mob_Pre) bound to plasmid pMV158 oriT DNA (22nt). Mn-bound crystal structure at pH 4.6 | Descriptor: | ACTTTAT oligonucleotide, ATAAAGTATAGTGTG oligonucleotide, GLYCEROL, ... | Authors: | Pluta, R, Boer, D.R, Coll, M. | Deposit date: | 2013-07-26 | Release date: | 2014-09-24 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Structural basis of a histidine-DNA nicking/joining mechanism for gene transfer and promiscuous spread of antibiotic resistance. Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
4LVL
| MobM Relaxase Domain (MOBV; Mob_Pre) bound to plasmid pMV158 oriT DNA (22nt+3'Thiophosphate). Mn-bound crystal structure at pH 6.8 | Descriptor: | CHLORIDE ION, DNA (5'-D(*AP*CP*TP*TP*TP*AP*T)-3'), DNA (5'-D(*AP*TP*AP*AP*AP*GP*TP*AP*TP*AP*GP*TP*GP*TP*GP*(TS6))-3'), ... | Authors: | Pluta, R, Boer, D.R, Coll, M. | Deposit date: | 2013-07-26 | Release date: | 2014-09-24 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Structural basis of a histidine-DNA nicking/joining mechanism for gene transfer and promiscuous spread of antibiotic resistance. Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
1JVW
| TRYPANOSOMA CRUZI MACROPHAGE INFECTIVITY POTENTIATOR (TCMIP) | Descriptor: | MACROPHAGE INFECTIVITY POTENTIATOR | Authors: | Pereira, P.J.B, Vega, M.C, Gonzalez-Rey, E, Fernandez-Carazo, R, Macedo-Ribeiro, S, Gomis-Rueth, F.X, Gonzalez, A, Coll, M. | Deposit date: | 2001-08-31 | Release date: | 2002-06-05 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Trypanosoma cruzi macrophage infectivity potentiator has a rotamase core and a highly exposed alpha-helix. EMBO Rep., 3, 2002
|
|
4LVJ
| MobM Relaxase Domain (MOBV; Mob_Pre) bound to plasmid pMV158 oriT DNA (22nt). Mn-bound crystal structure at pH 5.5 | Descriptor: | ACETATE ION, ACTTTAT oligonucleotide, ATAAAGTATAGTGTG oligonucleotide, ... | Authors: | Pluta, R, Boer, D.R, Coll, M. | Deposit date: | 2013-07-26 | Release date: | 2014-09-24 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (2.17 Å) | Cite: | Structural basis of a histidine-DNA nicking/joining mechanism for gene transfer and promiscuous spread of antibiotic resistance. Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
4A00
| Structure of an engineered aspartate aminotransferase | Descriptor: | ALANYL-PYRIDOXAL-5'-PHOSPHATE, ASPARTATE AMINOTRANSFERASE, DI(HYDROXYETHYL)ETHER, ... | Authors: | Fernandez, F.J, deVries, D, Pena-Soler, E, Coll, M, Christen, P, Gehring, H, Vega, M.C. | Deposit date: | 2011-09-06 | Release date: | 2011-12-28 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.34 Å) | Cite: | Structure and Mechanism of a Cysteine Sulfinate Desulfinase Engineered on the Aspartate Aminotransferase Scaffold. Biocim.Biophys.Acta, 1824, 2011
|
|
1S6M
| Conjugative Relaxase Trwc In Complex With Orit DNA. Metal-Bound Structure | Descriptor: | DNA (25-MER), NICKEL (II) ION, TrwC | Authors: | Guasch, A, Lucas, M, Moncalian, G, Cabezas, M, Perez-Luque, R, Gomis-Ruth, F.X, de la Cruz, F, Coll, M. | Deposit date: | 2004-01-26 | Release date: | 2005-06-14 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.28 Å) | Cite: | Unveiling the molecular mechanism of a conjugative relaxase: The structure of TrwC complexed with a 27-mer DNA comprising the recognition hairpin and the cleavage site. J.Mol.Biol., 358, 2006
|
|
1PCA
| THREE DIMENSIONAL STRUCTURE OF PORCINE PANCREATIC PROCARBOXYPEPTIDASE A. A COMPARISON OF THE A AND B ZYMOGENS AND THEIR DETERMINANTS FOR INHIBITION AND ACTIVATION | Descriptor: | CITRIC ACID, PROCARBOXYPEPTIDASE A PCPA, VALINE, ... | Authors: | Guasch, A, Coll, M, Aviles, F.X, Huber, R. | Deposit date: | 1991-10-28 | Release date: | 1993-10-31 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Three-dimensional structure of porcine pancreatic procarboxypeptidase A. A comparison of the A and B zymogens and their determinants for inhibition and activation. J.Mol.Biol., 224, 1992
|
|
1SAX
| Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | Deposit date: | 2004-02-09 | Release date: | 2004-04-27 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator J.Biol.Chem., 279, 2004
|
|
4MNB
| Crystal Structure of a complex between the marine anticancer drug Variolin B and DNA | Descriptor: | 5'-D(*CP*GP*TP*AP*CP*G)-3', 9-amino-5-(2-aminopyrimidin-4-yl)pyrido[3',2':4,5]pyrrolo[1,2-c]pyrimidin-4-ol, COBALT (II) ION, ... | Authors: | Canals, A, Arribas-Bosacoma, R, Alvarez, M, Albericio, F, Aymami, J, Coll, M. | Deposit date: | 2013-09-10 | Release date: | 2015-03-11 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (1.4 Å) | Cite: | Intercalative DNA binding of the marine anticancer drug variolin B. Sci Rep, 7, 2017
|
|
1RNF
| X-RAY CRYSTAL STRUCTURE OF UNLIGANDED HUMAN RIBONUCLEASE 4 | Descriptor: | PROTEIN (RIBONUCLEASE 4) | Authors: | Terzyan, S.S, Peracaula, R, De Llorens, R, Tsushima, Y, Yamada, H, Seno, M, Gomis-Rueth, F.X, Coll, M. | Deposit date: | 1998-10-29 | Release date: | 1999-10-29 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | The three-dimensional structure of human RNase 4, unliganded and complexed with d(Up), reveals the basis for its uridine selectivity. J.Mol.Biol., 285, 1999
|
|
1GL6
| Plasmid coupling protein TrwB in complex with the non-hydrolysable GTP analogue GDPNP | Descriptor: | 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ATPASE, CHLORIDE ION, ... | Authors: | Gomis-Ruth, F.X, Moncalian, G, De La cruz, F, Coll, M. | Deposit date: | 2001-08-28 | Release date: | 2002-05-16 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | The Bacterial Conjugation Protein Trwb Resembles Ring Helicases and F1-ATPase Nature, 409, 2001
|
|
1GL7
| Plasmid coupling protein TrwB in complex with the non-hydrolisable ATP-analogue ADPNP. | Descriptor: | CHLORIDE ION, CONJUGAL TRANSFER PROTEIN TRWB, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER | Authors: | Gomis-Ruth, F.X, Moncalian, G, De La cruz, F, Coll, M. | Deposit date: | 2001-08-28 | Release date: | 2002-05-16 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The Bacterial Conjugation Protein Trwb Resembles Ring Helicases and F1-ATPase Nature, 409, 2001
|
|