Loading
PDBj
MenuPDBj@FacebookPDBj@X(formerly Twitter)PDBj@BlueSkyPDBj@YouTubewwPDB FoundationwwPDBDonate
RCSB PDBPDBeBMRBAdv. SearchSearch help

6L92

A basket type G-quadruplex in WNT DNA promoter

Summary for 6L92
Entry DOI10.2210/pdb6l92/pdb
DescriptorDNA (5'-D(*GP*GP*GP*CP*CP*AP*CP*CP*GP*GP*GP*CP*AP*GP*TP*GP*GP*GP*CP*GP*GP*G)-3') (1 entity in total)
Functional Keywordsg-quadruplex, dna promoter, wnt, dna
Biological sourceHomo sapiens
Total number of polymer chains1
Total formula weight6900.42
Authors
Wang, Z.F.,Li, M.H.,Chu, I.T.,Winnerdy, F.R.,Phan, A.T.,Chang, T.C. (deposition date: 2019-11-08, release date: 2019-12-11, Last modification date: 2024-05-15)
Primary citationWang, Z.F.,Li, M.H.,Chu, I.T.,Winnerdy, F.R.,Phan, A.T.,Chang, T.C.
Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.
Nucleic Acids Res., 48:1120-1130, 2020
Cited by
PubMed Abstract: Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.
PubMed: 31912153
DOI: 10.1093/nar/gkz1207
PDB entries with the same primary citation
Experimental method
SOLUTION NMR
Structure validation

257179

PDB entries from 2026-07-29

PDB statisticsPDBj update infoContact PDBjnumon