6L92

A basket type G-quadruplex in WNT DNA promoter

Summary for 6L92

• Entry DOI: 10.2210/pdb6l92/pdb
• Descriptor: DNA (5'-D(*GP*GP*GP*CP*CP*AP*CP*CP*GP*GP*GP*CP*AP*GP*TP*GP*GP*GP*CP*GP*GP*G)-3') (1 entity in total)
• Functional Keywords: g-quadruplex, dna promoter, wnt, dna
• Biological source: Homo sapiens
• Total number of polymer chains: 1
• Total formula weight: 6900.42

Authors

Wang, Z.F.,Li, M.H.,Chu, I.T.,Winnerdy, F.R.,Phan, A.T.,Chang, T.C. (deposition date: 2019-11-08, release date: 2019-12-11, Last modification date: 2024-05-15)

Primary citation

Wang, Z.F.,Li, M.H.,Chu, I.T.,Winnerdy, F.R.,Phan, A.T.,Chang, T.C.
Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.
Nucleic Acids Res., 48:1120-1130, 2020

PubMed Abstract: Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

PubMed: 31912153
DOI: 10.1093/nar/gkz1207

Experimental method

SOLUTION NMR