Loading
PDBj
MenuPDBj@FacebookPDBj@X(formerly Twitter)PDBj@BlueSkyPDBj@YouTubewwPDB FoundationwwPDBDonate
RCSB PDBPDBeBMRBAdv. SearchSearch help

6GH0

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure

Summary for 6GH0
Entry DOI10.2210/pdb6gh0/pdb
NMR InformationBMRB: 34269
DescriptorDNA (5'-D(*GP*GP*CP*GP*AP*GP*GP*AP*GP*GP*GP*GP*CP*GP*TP*GP*GP*CP*CP*GP*GP*C)-3') (1 entity in total)
Functional Keywordsg-quadruplex, two g-quartets, c-kit promoter, dna
Biological sourceHomo sapiens
Total number of polymer chains1
Total formula weight6940.44
Authors
Kotar, A.,Rigo, R.,Sissi, C.,Plavec, J. (deposition date: 2018-05-04, release date: 2019-01-09, Last modification date: 2024-05-15)
Primary citationKotar, A.,Rigo, R.,Sissi, C.,Plavec, J.
Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.
Nucleic Acids Res., 47:2641-2653, 2019
Cited by
PubMed Abstract: In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.
PubMed: 30590801
DOI: 10.1093/nar/gky1269
PDB entries with the same primary citation
Experimental method
SOLUTION NMR
Structure validation

256448

PDB entries from 2026-07-15

PDB statisticsPDBj update infoContact PDBjnumon