5E3M

Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)

Summary for 5E3M

Related5E3L 5E3N 5E3O
DescriptorDNA-binding protein Fis, DNA (27-MER), ... (4 entities in total)
Functional Keywordsprotein-dna complex, hth domain, minor groove compression, dna bending, indirect recognition, dna binding protein-dna complex, dna binding protein/dna
Biological sourceEscherichia coli
More
Total number of polymer chains4
Total molecular weight39092.63
Authors
Stella, S.,Hancock, S.P.,Cascio, D.,Johnson, R.C. (deposition date: 2015-10-03, release date: 2016-03-09, Last modification date: 2016-03-23)
Primary citation
Hancock, S.P.,Stella, S.,Cascio, D.,Johnson, R.C.
DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11:e0150189-e0150189, 2016
PubMed: 26959646 (PDB entries with the same primary citation)
DOI: 10.1371/journal.pone.0150189
MImport into Mendeley
Experimental method
X-RAY DIFFRACTION (2.886 Å)
?

Structure validation

RfreeClashscoreRamachandran outliersSidechain outliersRSRZ outliers0.229302.4%0.8%MetricValuePercentile RanksWorseBetterPercentile relative to all X-ray structuresPercentile relative to X-ray structures of similar resolution