5BTF
Crystal structure of a topoisomerase II complex
Summary for 5BTF
Entry DOI | 10.2210/pdb5btf/pdb |
Descriptor | DNA gyrase subunit A, DNA gyrase subunit B, DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA, ... (7 entities in total) |
Functional Keywords | protein-dna complex, topoisomerase ii, isomerase-dna complex, isomerase/dna |
Biological source | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) More |
Total number of polymer chains | 8 |
Total formula weight | 199318.79 |
Authors | Blower, T.R.,Williamson, B.H.,Kerns, R.J.,Berger, J.M. (deposition date: 2015-06-03, release date: 2016-03-02, Last modification date: 2023-11-15) |
Primary citation | Blower, T.R.,Williamson, B.H.,Kerns, R.J.,Berger, J.M. Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis. Proc.Natl.Acad.Sci.USA, 113:1706-1713, 2016 Cited by PubMed: 26792525DOI: 10.1073/pnas.1525047113 PDB entries with the same primary citation |
Experimental method | X-RAY DIFFRACTION (2.61 Å) |
Structure validation
Download full validation report