Loading
PDBj
MenuPDBj@FacebookPDBj@X(formerly Twitter)PDBj@BlueSkyPDBj@YouTubewwPDB FoundationwwPDBDonate
RCSB PDBPDBeBMRBAdv. SearchSearch help

9RJS

Structure of the Bacteriophage PhiKZ non-virion RNA Polymerase bound to an analogue of its promoter

Entity
Entity IDChain IDDescriptionTypeChain lengthFormula weightNumber of moleculesDB Name (Accession)Biological sourceDescriptive keywords
1A
(A)
DNA-directed RNA polymerase,PHIKZ056.1polymer50857976.61UniProt (I7DB47)
UniProt (L7T138)
Phikzvirus phiKZ
2B
(B)
PHIKZ068polymer52159442.81UniProt (Q8SD94)Phikzvirus phiKZ
3C
(C)
PHIKZ071polymer70078780.51UniProt (by SIFTS) (I7DB36)Phikzvirus phiKZ
4D
(D)
PHIKZ074polymer67777513.51UniProt (Q8SD88)Phikzvirus phiKZ
5E
(E)
PHIKZ123polymer54362959.11UniProt (Q8SD39)Phikzvirus phiKZ
6F
(X)
DNA - ATGAGTAATTTTAGTGAATGTATTTGCTATATTGCTATGTAGACAGTTCCCAAAAGCCTAAAGTTACAATATAGGpolymer7523219.01Phikzvirus phiKZ
7G
(Y)
DNA - CCTATATTGTAACTTTAGGCTTTTGGGAACTCCTCTCATATTCCCATAGCAAATACATTCACTAAAATTACTCATpolymer7522881.71Phikzvirus phiKZ
8H, I
(A, D)
ZINC IONnon-polymer65.42Chemie (ZN)
Sequence modifications
A: 1 - 421 (UniProt: I7DB47)
PDBExternal DatabaseDetails
Met -19-initiating methionine
Gly -18-expression tag
Ser -17-expression tag
Ser -16-expression tag
His -15-expression tag
His -14-expression tag
His -13-expression tag
His -12-expression tag
His -11-expression tag
His -10-expression tag
Ser -9-expression tag
Ser -8-expression tag
Gly -7-expression tag
Leu -6-expression tag
Val -5-expression tag
Pro -4-expression tag
Arg -3-expression tag
Gly -2-expression tag
Ser -1-expression tag
His 0-expression tag
Asn 11Asp 11conflict
Gln 422-linker
Leu 423-linker
Asn 424-linker
Leu 425-linker
Thr 426-linker
Leu 427-linker
A: 428 - 488 (UniProt: L7T138)
B: 1 - 521 (UniProt: Q8SD94)
PDBExternal DatabaseDetails
Glu 2Gln 2conflict
His 78Asp 78conflict
E: 1 - 543 (UniProt: Q8SD39)
PDBExternal DatabaseDetails
Gly 197Asp 197conflict
Sequence viewer
Contents of the asymmetric unit
PolymersNumber of chains7
Total formula weight382773.1
Non-Polymers*Number of molecules2
Total formula weight130.8
All*Total formula weight382903.9
*Water molecules are not included.

243531

PDB entries from 2025-10-22

PDB statisticsPDBj update infoContact PDBjnumon