6W3L
APE1 exonuclease substrate complex wild-type
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | A (C) | TCGACGGATCC | polymer | 11 | 3334.2 | 1 | synthetic construct | ||
| 2 | B (D) | GCTGATGCG(C7R) | polymer | 10 | 3077.1 | 1 | synthetic construct | ||
| 3 | C (E) | GGATCCGTCGATCGCATCAGC | polymer | 21 | 6424.1 | 1 | synthetic construct | ||
| 4 | D, E (A, B) | DNA-(apurinic or apyrimidinic site) lyase | polymer | 276 | 31188.5 | 2 | UniProt (P27695) Pfam (PF03372) | Homo sapiens (Human) | APEX nuclease,APEN,Apurinic-apyrimidinic endonuclease 1,APE-1,REF-1,Redox factor-1 |
| 5 | F (D) | CALCIUM ION | non-polymer | 40.1 | 1 | Chemie (CA) | |||
| 6 | G, I (E, A) | SODIUM ION | non-polymer | 23.0 | 2 | Chemie (NA) | |||
| 7 | H (A) | 1,2-ETHANEDIOL | non-polymer | 62.1 | 1 | Chemie (EDO) | |||
| 8 | J, K, L, M (D, E, A, B) | water | water | 18.0 | 100 | Chemie (HOH) |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 5 |
| Total formula weight | 75212.5 | |
| Non-Polymers* | Number of molecules | 4 |
| Total formula weight | 148.1 | |
| All* | Total formula weight | 75360.6 |
