5T7B
Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrTTR guide RNA complex
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | A (R) | RNA (UVP)UAUAGAGCAAGAACACUGUU | polymer | 21 | 6733.1 | 1 | Mus musculus | ||
| 2 | B (A) | Protein argonaute-2 | polymer | 861 | 97476.3 | 1 | UniProt (Q9UKV8) Pfam (PF16486) Pfam (PF08699) Pfam (PF02170) Pfam (PF16488) Pfam (PF16487) Pfam (PF02171) | Homo sapiens (Human) | hAgo2,Argonaute RISC catalytic component 2,Eukaryotic translation initiation factor 2C 2,eIF2C 2,PAZ Piwi domain protein,PPD,Protein slicer |
| 3 | C, D (A) | PHENOL | non-polymer | 94.1 | 2 | Chemie (IPH) PubChem (996) | |||
| 4 | E (A) | water | water | 18.0 | 9 | Chemie (HOH) |
Sequence modifications
A: 1 - 859 (UniProt: Q9UKV8)
| PDB | External Database | Details |
|---|---|---|
| Gly -1 | - | expression tag |
| Ala 0 | - | expression tag |
| Asn 597 | Asp 597 | engineered mutation |
| Asn 669 | Asp 669 | engineered mutation |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 2 |
| Total formula weight | 104209.4 | |
| Non-Polymers* | Number of molecules | 2 |
| Total formula weight | 188.2 | |
| All* | Total formula weight | 104397.6 |






