5BTC
Crystal structure of a topoisomerase II complex
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | A, C (A, C) | DNA gyrase subunit A | polymer | 503 | 56225.4 | 2 | UniProt (P9WG47) Pfam (PF00521) | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) | |
| 2 | B, D (B, D) | DNA gyrase subunit B | polymer | 253 | 28272.4 | 2 | UniProt (P9WG45) Pfam (PF01751) Pfam (PF00986) | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) | |
| 3 | E, H (E, H) | DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA | polymer | 24 | 7417.8 | 2 | synthetic construct | ||
| 4 | F, G (F, G) | DNA substrate 24-mer TTACGTGCATAGTCATTCATGACC | polymer | 24 | 7319.7 | 2 | synthetic construct | ||
| 5 | I, J, K, L (A, B, C, D) | MAGNESIUM ION | non-polymer | 24.3 | 4 | Chemie (MG) PubChem (888) | |||
| 6 | M, N (G) | 1-CYCLOPROPYL-6-FLUORO-4-OXO-7-PIPERAZIN-1-YL-1,4-DIHYDROQUINOLINE-3-CARBOXYLIC ACID | non-polymer | 331.3 | 2 | Chemie (CPF) PubChem (2764) | |||
| 7 | O, P, Q, R, S... (A, B, C, D, E...) | water | water | 18.0 | 217 | Chemie (HOH) |
Sequence modifications
A, C: 2 - 500 (UniProt: P9WG47)
B, D: 426 - 675 (UniProt: P9WG45)
| PDB | External Database | Details |
|---|---|---|
| Ser 90 | Ala 90 | engineered mutation |
| Ile 501 | - | expression tag |
| Gly 502 | - | expression tag |
| Ser 503 | - | expression tag |
| Gly 504 | - | expression tag |
| PDB | External Database | Details |
|---|---|---|
| Ser 423 | - | expression tag |
| Asn 424 | - | expression tag |
| Ala 425 | - | expression tag |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 8 |
| Total formula weight | 198470.8 | |
| Non-Polymers* | Number of molecules | 6 |
| Total formula weight | 759.9 | |
| All* | Total formula weight | 199230.7 |






