5BTA

Crystal structure of a topoisomerase II complex

Entity

Entity ID	Chain ID	Description	Type	Chain length	Formula weight	Number of molecules	DB Name (Accession)	Biological source	Descriptive keywords
1	A, C (A, C)	DNA gyrase subunit A	polymer	503	56225.4	2	UniProt (P9WG47) Pfam (PF00521)	Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
2	B, D (B, D)	DNA gyrase subunit B	polymer	253	28272.4	2	UniProt (P9WG45) Pfam (PF01751) Pfam (PF00986)	Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
3	E, H (E, H)	DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA	polymer	24	7417.8	2		synthetic construct
4	F, G (F, G)	DNA substrate 24-mer TTACGTGCATAGTCATTCATGACC	polymer	24	7319.7	2		synthetic construct
5	I, J, K, L (A, B, C, D)	MAGNESIUM ION	non-polymer		24.3	4	Chemie (MG) PubChem (888)
6	M, N (G, H)	1-cyclopropyl-6-fluoro-8-methoxy-7-[(4aS,7aS)-octahydro-6H-pyrrolo[3,4-b]pyridin-6-yl]-4-oxo-1,4-dihydroquinoline-3-carboxylic acid	non-polymer		401.4	2	Chemie (MFX) PubChem (69182904) PubChem (73265245) PubChem (4259) PubChem (101527) PubChem (152946) PubChem (5742713) PubChem (11632736) PubChem (146430276)
7	O, P, Q, R, S... (A, B, C, D, E...)	water	water		18.0	217	Chemie (HOH)

Sequence modifications

A, C: 2 - 500 (UniProt: P9WG47)

PDB	External Database	Details
Ser 90	Ala 90	engineered mutation
Ile 501	-	expression tag
Gly 502	-	expression tag
Ser 503	-	expression tag
Gly 504	-	expression tag

B, D: 426 - 675 (UniProt: P9WG45)

PDB	External Database	Details
Ser 423	-	expression tag
Asn 424	-	expression tag
Ala 425	-	expression tag

Contents of the asymmetric unit

Polymers	Number of chains	8
	Total formula weight	198470.8
Non-Polymers*	Number of molecules	6
	Total formula weight	900.1
All*	Total formula weight	199370.9

*Water molecules are not included.