4P0R
human Mus81-Eme1-3'flap DNA complex
Entity
Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
1 | A, C | Crossover junction endonuclease MUS81 | polymer | 306 | 34015.8 | 2 | UniProt (Q96NY9) Pfam (PF02732) Pfam (PF21292) In PDB | Homo sapiens (Human) | |
2 | B, D | Crossover junction endonuclease EME1 | polymer | 393 | 43740.9 | 2 | UniProt (Q96AY2) Pfam (PF02732) Pfam (PF21292) In PDB | Homo sapiens (Human) | MMS4 homolog,hMMS4 |
3 | E, H | DNA CTGTGTGTAAGCACG | polymer | 15 | 4625.0 | 2 | synthetic construct | ||
4 | F, I | DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT | polymer | 32 | 9905.4 | 2 | synthetic construct | ||
5 | G, J | DNA CAAGTTCACCCTAACCTCAG | polymer | 20 | 6022.9 | 2 | synthetic construct |
Sequence viewer
Contents of the asymmetric unit
Polymers | Number of chains | 10 |
Total formula weight | 196620.0 | |
All* | Total formula weight | 196620.0 |