4P0R
human Mus81-Eme1-3'flap DNA complex
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | A, C (A, C) | Crossover junction endonuclease MUS81 | polymer | 306 | 34015.8 | 2 | UniProt (Q96NY9) Pfam (PF02732) Pfam (PF21292) | Homo sapiens (Human) | |
| 2 | B, D (B, D) | Crossover junction endonuclease EME1 | polymer | 393 | 43740.9 | 2 | UniProt (Q96AY2) Pfam (PF02732) Pfam (PF21292) | Homo sapiens (Human) | MMS4 homolog,hMMS4 |
| 3 | E, H (E, H) | DNA CTGTGTGTAAGCACG | polymer | 15 | 4625.0 | 2 | synthetic construct | ||
| 4 | F, I (F, I) | DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT | polymer | 32 | 9905.4 | 2 | synthetic construct | ||
| 5 | G, J (G, J) | DNA CAAGTTCACCCTAACCTCAG | polymer | 20 | 6022.9 | 2 | synthetic construct |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 10 |
| Total formula weight | 196620.0 | |
| All* | Total formula weight | 196620.0 |
