2M93

Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid

Entity

Entity ID	Chain ID	Description	Type	Chain length	Formula weight	Number of molecules	DB Name (Accession)	Biological source	Descriptive keywords
1	A	32-MER DNA	polymer	32	10066.4	1

Contents of the asymmetric unit

Polymers	Number of chains	1
	Total formula weight	10066.4
All*	Total formula weight	10066.4

*Water molecules are not included.