2M93
Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords | 
| 1 | A (A)  | 32-MER DNA | polymer | 32 | 10066.4 | 1 | 
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 1 | 
| Total formula weight | 10066.4 | |
| All* | Total formula weight | 10066.4 | 






