2M93
Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid
Entity
Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
1 | A | 32-MER DNA | polymer | 32 | 10066.4 | 1 |
Sequence viewer
Contents of the asymmetric unit
Polymers | Number of chains | 1 |
Total formula weight | 10066.4 | |
All* | Total formula weight | 10066.4 |