1KX3
X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | A, B (I, J) | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') | polymer | 146 | 45053.9 | 2 | Homo sapiens (human) | ||
| 2 | C, G (A, E) | histone H3 | polymer | 135 | 15303.9 | 2 | UniProt (P84233) Pfam (PF00125) | Xenopus laevis (African clawed frog) | |
| 3 | D, H (B, F) | histone H4 | polymer | 102 | 11263.2 | 2 | UniProt (P62799) Pfam (PF15511) | Xenopus laevis (African clawed frog) | |
| 4 | E, I (C, G) | histone H2A.1 | polymer | 128 | 13907.2 | 2 | UniProt (P06897) Pfam (PF00125) Pfam (PF16211) | Xenopus laevis (African clawed frog) | |
| 5 | F, J (D, H) | histone H2B.2 | polymer | 125 | 13848.1 | 2 | UniProt (P02281) Pfam (PF00125) | Xenopus laevis (African clawed frog) | |
| 6 | K, L, M, N, O... (I, J, E) | MANGANESE (II) ION | non-polymer | 54.9 | 13 | Chemie (MN) | |||
| 7 | AA, BA, CA, DA, EA... (B, C, D, E, F...) | water | water | 18.0 | 943 | Chemie (HOH) |
Sequence modifications
A, E: 1 - 135 (UniProt: P84233)
C, G: 1 - 128 (UniProt: P06897)
D, H: -2 - 122 (UniProt: P02281)
| PDB | External Database | Details |
|---|---|---|
| Ala 102 | Gly 102 | conflict |
| PDB | External Database | Details |
|---|---|---|
| Arg 99 | Gly 99 | variant |
| Ser 123 | Ala 123 | conflict |
| - | Ala 126 | deletion |
| PDB | External Database | Details |
|---|---|---|
| Thr 29 | Ser 32 | variant |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 10 |
| Total formula weight | 198752.6 | |
| Non-Polymers* | Number of molecules | 13 |
| Total formula weight | 714.2 | |
| All* | Total formula weight | 199466.7 |






