5E3N

Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)

Experimental procedure

Experimental method	SINGLE WAVELENGTH
Source type	SYNCHROTRON
Source details	APS BEAMLINE 24-ID-C
Synchrotron site	APS
Beamline	24-ID-C
Temperature [K]	100
Detector technology	CCD
Collection date	2011-03-05
Detector	ADSC QUANTUM 315
Wavelength(s)	0.97949
Spacegroup name	P 21 21 21
Unit cell lengths	43.190, 92.980, 153.940
Unit cell angles	90.00, 90.00, 90.00

Refinement procedure

Resolution	39.794 - 2.660
R-factor	0.2184
Rwork	0.217
R-free	0.25230
Structure solution method	MOLECULAR REPLACEMENT
RMSD bond length	0.014
RMSD bond angle	1.131
Data scaling software	Aimless (0.5.14)
Phasing software	PHASER (2.2.1)
Refinement software	PHENIX ((phenix.refine: 1.9_1692))

Data quality characteristics

	Overall	Inner shell	Outer shell
Low resolution limit [Å]	92.980	92.980	2.800
High resolution limit [Å]	2.660	8.400	2.660
Rmerge	0.098	0.061	0.620
Rpim	0.038	0.026	0.241
Total number of observations	142367	4359	19357
Number of reflections	18640
<I/σ(I)>	10.3	17.6	2.5
Completeness [%]	99.9	98.8	99.9
Redundancy	7.6	6.5	7.3
CC(1/2)	0.996	0.994	0.918

Crystallization Conditions

crystal ID	method	pH	temperature	details
1	VAPOR DIFFUSION, HANGING DROP	8.5	277	0.2 M Sodium citrate, 0.1 M TRIS-HCl pH 8.5, 36% PEG 400