1K1S

Crystal Structure of DinB from Sulfolobus solfataricus

Experimental procedure

Experimental method	SINGLE WAVELENGTH
Source type	SYNCHROTRON
Source details	NSLS BEAMLINE X25
Synchrotron site	NSLS
Beamline	X25
Temperature [K]	100
Detector technology	CCD
Collection date	2001-07-26
Detector	BRANDEIS - B4
Wavelength(s)	1.1
Spacegroup name	P 62
Unit cell lengths	113.040, 113.040, 62.580
Unit cell angles	90.00, 90.00, 120.00

Refinement procedure

Resolution	37.000 - 2.800
R-factor	0.237 *
Rwork	0.237
R-free	0.27900
Structure solution method	MOLECULAR REPLACEMENT
Starting model (for MR)	1im4
RMSD bond length	0.004
RMSD bond angle	0.900
Data reduction software	DENZO
Data scaling software	SCALEPACK
Phasing software	AMoRE
Refinement software	CNS (1.0)

Data quality characteristics

	Overall	Outer shell
Low resolution limit [Å]	37.000	2.900
High resolution limit [Å]	2.800	2.800
Rmerge	0.080	0.501
Number of reflections	11002
<I/σ(I)>	20.1	4.7
Completeness [%]	99.9	100
Redundancy	7.1	7.1

Crystallization Conditions

crystal ID	method	pH	temperature	details
1	VAPOR DIFFUSION, HANGING DROP	6.2	298	Peg2000, sodium cacodylate, sodium fluoride, magnesium chloride, sucrose monolaurate, dATP, DNA hairpin (5' TTTTTTTTTTAGATGTCGATGCAATCGACATCT* 3' terminated by 3'deoxythymine ), pH 6.2, VAPOR DIFFUSION, HANGING DROP, temperature 298.0K

Crystallization Reagents in Literatures

ID	crystal ID	solution	reagent name	concentration (unit)	details
1	1	drop	PEG2000	20 (%(w/v))
10	1	reservoir	glycerol	40 (%(v/v))
2	1	drop	sodium cacodylate	0.1 (M)
3	1	drop		0.2 (M)
4	1	drop		5 (mM)
5	1	drop	sucrose monolaurate	0.2 (mM)
6	1	reservoir	PEG2000	10 (%(v/v))
7	1	reservoir	sodium cacodylate	50 (mM)
8	1	reservoir		0.1 (M)
9	1	reservoir		5 (mM)